Labshake search
Citations for Agilent :
4901 - 4950 of 6226 citations for Cow Protein L Isoaspartate PCMT1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... Precise measurements of glycolysis in ILC2s were carried out using the Seahorse XF Glycolytic Rate Assay Kit (Agilent; 103344-100) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Average library molecular size was determined using the DNA High Sensitivity Assay kit with the Agilent 2100 Bioanalyzer (Agilent Technologies). The Library was then used to generate paired end reads over 150 cycles at the UC Davis DNA Sequencing Technologies Core facility on the Illumina HiSeq 4000 system.
-
bioRxiv - Microbiology 2021Quote: ... and average fragment size of each sample was assessed using an Agilent 2100 Bioanalyzer system and RNA 6000 Nano kit (Agilent) prior to sequencing ...
-
bioRxiv - Neuroscience 2020Quote: ... conversion of both the pre TM1 and the TM2-TM3 loop from the chimera to the corresponding α9 sequence was performed by QuikChange Multi Site-Directed Mutagenesis kit (Stratagene) using primers 5’GGCATGCTCTCGGCCACCATCAGCTGGAAGACGG3’ and 5’GGGCAGCAGGAGGTTGACGATGTAGAATGAAGAGCGGCGCTTCAG3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... The size of the resulting libraries was controlled by the use of a Bioanalyzer High Sensitivity DNA Kit (Agilent Technologies) and quantified using the KAPA Library Quantification Kit for Illumina (Roche) ...
-
bioRxiv - Microbiology 2022Quote: ... The panel of individual RBM mutations in the full-length SARS-CoV-2 Spike expressor and the Spike from the B.1.429 lineage (S13I, W152C, L452R, D614G) were generated using the QuikChange II XL site-directed mutagenesis kit (Agilent Technologies) and were previously reported25 ...
-
bioRxiv - Neuroscience 2022Quote: ... quantified using a Qubit RNA assay kit and checked for quality using a High Sensitivity RNA ScreenTape on a TapesStation (Agilent). RNA integrity scores are typically 7.0 and greater ...
-
bioRxiv - Immunology 2022Quote: E382R/S/A mutations were introduced into IgG1 Fc encoded within a pFUSE-hIgG1-Fc vector using site-directed mutagenesis (QuikChange II kit, Agilent), using mutagenic primers (Supplementary Table 4 ...
-
bioRxiv - Neuroscience 2022Quote: ... the RIN (RNA integrity number) value of RNA isolated from tissue culture was determined using the Agilent RNA 6000 Pico Kit (#5067-1513 Agilent) with a 2100 Bioanalyzer (#G2939BA Agilent ...
-
bioRxiv - Molecular Biology 2022Quote: ... Libraries were verified on an Agilent 2100 bioanalyzer with a High Sensitivity DNA Kit (Agilent Technologies, Santa Clara, CA, USA) for the average fragment length calculation and evaluation of quality and on Qubit 2.0 ...
-
bioRxiv - Biochemistry 2022Quote: Human ALDH9A1 mutants were generated from the template plasmid (EX-Z3075-M29) described above using a QuickChange XL II Site-Directed Mutagenesis Kit (Agilent). Primers were designed with the corresponding mutations as prescribed by the QuickChange Primer Design tool (https://www.agilent.com/store/primerDesignProgram.jsp ...
-
bioRxiv - Cancer Biology 2022Quote: ... cleaned by a 0.6X AMPure XP bead cleanup and quantified on a 2100 Bioanalyzer Instrument following the manufacturer’s protocol “Agilent High Sensitivity DNA Kit” (G2938-90321, Agilent Technologies). This procedure was done twice for every fraction selected ...
-
bioRxiv - Cancer Biology 2022Quote: ... cDNA quantification was performed using the Agilent Bioanalyzer High Sensitivity Kit on an Agilent Bioanalyzer 2100 (Agilent Technologies, CA, USA). cDNA libraries were sequenced on an Illumina NovaSeq 6000 sequencer using the SP flowcell (200 cycles ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). RNA-sequencing was performed according to the standard protocol of Novogene Corporation Inc ...
-
bioRxiv - Cancer Biology 2022Quote: ... All four Single Cell 3’ Gene Expression libraries were quantified on a 2100 Bioanalyzer Instrument following the manufacturer’s protocol “Agilent DNA 7500 kit” (G2938-90024, Agilent Technologies). These Single Cell 3’ Gene Expression libraries were combined to create one sequence library pool which was quantified by qPCR ...
-
bioRxiv - Cancer Biology 2022Quote: ... The stranded mRNA libraries were analyzed on a 2100 Bioanalyzer instrument following the manufacturer’s protocol “Agilent DNA 7500 kit” (G2938-90024, Agilent Technologies), diluted to 10nM and pooled equimolar into multiplex sequencing pools for sequencing on the HiSeq 2500 and NovaSeq 6000 Illumina sequencing platforms ...
-
bioRxiv - Cancer Biology 2022Quote: ... All K-Ras secondary mutant and wild-type K-Ras constructs were generated by a PCR based strategy using a site-directed mutagenesis kit (Stratagene) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... incapable of binding DNA was generated by introducing point mutations into the pENTR-Nr2f6 construct using a QuikChange II XL Site Directed Mutagenesis Kit (Agilent), and the inserts were subsequently cloned into pLX304 (lentiviral ...
-
bioRxiv - Cancer Biology 2022Quote: ... All stainings were performed using the DAKO Link 48 Autostainer Platform and the EnVision FLEX Visualization kit (DAKO, cat# K8002) according to standard diagnostic routine protocols and manufacturer instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Exome sequencing was performed by Macrogen Inc (Seoul, South Korea) or BGI (Shenzhen, China) with SureSelect V5 Exome Capture Kit (Agilent) and sequencing on Illumina HiSeq ...
-
bioRxiv - Biochemistry 2022Quote: ... Mutations into the TMD were introduced by site-directed mutagenesis using the Quick Change II kit following the manufacturer’s instructions (Agilent Technologies). All DNA manipulations were confirmed by the sequencing of plasmid DNAs (Macrogen Spain) ...
-
bioRxiv - Biochemistry 2022Quote: ... Site-directed mutagenesis of POLID was performed on pTOPO-FLID-WT using the QuikChange Multi Site-Directed Mutagenesis Kit (Agilent) with primers POLID M1 and POLID M2 to generate pTOPO-FLID-Poldead ...
-
bioRxiv - Cell Biology 2022Quote: ... The stop codon between MYO10 and BioID was then replaced with a codon encoding valine (GTA) using a quick-change mutagenesis kit from Agilent and following the manufacturers’ instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... The recombinant pET30a-hOGG1 was used as a template to introduce Y203A and N149A/N150A (referred to as 2NA) substitutions using the Quick-Change kit (Agilent) using primers indicated in Table S2 ...
-
bioRxiv - Cell Biology 2022Quote: ... losing nuclear localization was generated by mutating the lysine residues at 472 and 473 to alanine residues (KK472/473AA) via the QuickChange site-directed mutagenesis kit (Stratagene). The same approach was used to generate tyrosine phospho-defective PFKFB3 at the indicated residues by replacing tyrosine with phenylalanine ...
-
SMDT1 variants impair EMRE-mediated mitochondrial calcium uptake in patients with muscle involvementbioRxiv - Genetics 2022Quote: ... exome enrichment was performed using the SureSelect Human All Exon 50 Mb Kit V5 (Agilent Technologies, Santa Clara, CA, USA). Sequencing was done on a HiSeq4000 (Illumina ...
-
Species-specific protein-protein interactions govern the humanization of the 20S proteasome in yeastbioRxiv - Genetics 2022Quote: The PSMB7 mutant gene library was previously generated (Kachroo et al, 2015) by error-prone PCR (GeneMorph II Random Mutagenesis Kit from Agilent) to introduce mutations and add attL1 and attL2 sites at the 5’ and 3’ ends of the gene (Reece-Hoyes & Walhout ...
-
bioRxiv - Genomics 2022Quote: ... RNA quality was assessed by resolving the 18S and 28S ribosomal RNA bands using the Agilent 2100 Bioanalyzer and the RNA 6000 Nano kit (Agilent). RNA-seq libraries were constructed using TruSeq Stranded Total RNA sample prep kit (Illumina) ...
-
bioRxiv - Genetics 2022Quote: ... ADAR1 point mutations were generated based on the ADAR1p150 sequence using the QuickChange II XL site-directed mutagenesis kit (Agilent). The doxycycline-inducible MDA5 construct was generated by replacing dCas9 with MDA5 CDS in the HR-TRE3G-dCas9-GCN4-10x-p2a-mCherry backbone ...
-
bioRxiv - Immunology 2022Quote: ... The SCIV construct was then used to create allelic variants at position 375 using the QuikChange II XL site-directed mutagenesis kit (Agilent). Wild-type and mutant plasmids were transformed into MAX Efficiency Stbl2 competent cells (ThermoFisher Scientific ...
-
bioRxiv - Genetics 2022Quote: ... The integrity of the HMW gDNA was verified on the Femto Pulse system using the Genomic DNA 165 kb Kit (Agilent Technologies ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Genetics 2022Quote: ... the other mtr4 mutant plasmids were constructed by site-directed mutagenesis of the MTR4 HIS CEN6 plasmid (pAC4096) with the QuikChange II Site-Directed Mutagenesis Kit (Agilent) and oligonucleotides containing the corresponding missense mutations ...
-
bioRxiv - Microbiology 2022Quote: ... Quality assessment and library size estimation of the individual libraries was done using an HS DNA kit (Agilent, #5067-4626) in a Bio analyzer 2100 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 ng of extracted PCR products were analyzed by an Agilent High Sensitivity DNA kit on an Agilent 2100 Bioanalyzer (Agilent), and the remainder was cloned by using PCR Cloning Kit (New England Biolabs ...
-
bioRxiv - Microbiology 2022Quote: ... The RNA quality was assessed using the Agilent 2100 Bioanalyzer using RNA 6000 Pico kit (Agilent Technologies, Santa Clara, CA). qRT-PCR probe and primer sets (Table S2 ...
-
bioRxiv - Plant Biology 2022Quote: ... the concentration and fragment sizes of the DNA libraries were evaluated using the TapeStation 4200 kit (Agilent Technologies, United States) and the High Sensitivity D1000 kit.
-
bioRxiv - Molecular Biology 2023Quote: ... Site-directed mutagenesis was used to introduce mutations into the putative miR-423-5p binding sites on the Cacna2d2 3’UTR using the QuickChange II XL site-direct mutagenesis kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA integrity (RIN R 8.0) was confirmed using the High Sensitivity RNA Analysis Kit (DNF-472-0500, Agilent formerly AATI) on a 12-Capillary Fragment Analyzer ...
-
bioRxiv - Neuroscience 2023Quote: ... Amplified DNA from F1 mutants was used for cloning with the StrataClone PCR Cloning Kit (Agilent; Santa Clara, CA, USA) and then transformed with StrataClone SoloPack (Agilent ...
-
bioRxiv - Neuroscience 2023Quote: ... Quality and quantity assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). Sequencing libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB ...
-
bioRxiv - Immunology 2022Quote: ... Quality check was performed with the Bioanalyzer 2100 using the Agilent High Sensitivity DNA Kit (both Agilent, Santa Clara, USA). Pooled sequencing-ready libraries of the WTA and sample tag were sequenced on Illumina NovaSeq 6000 (150 bp ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... We extracted RNA using the Qiagen RNeasy Blood and Tissue Kit and checked RNA integrity with a TapeStation 2200 (Agilent). Only two samples had RNA integrity numbers (RIN ...
-
bioRxiv - Neuroscience 2022Quote: RNA-Sequencing RNA was extracted from dorsal hippocampus (DH) 500 µm punches and RNA quality and concentration was evaluated using RNA 6000 pico kit for Bioanalyzer (Agilent) with a cutoff of 9 for the RIN ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Agilent Bioanalyzer 2100 system (Agilent Technologies, USA). Sequencing libraries were generated using the NEBNext UltraTM RNA Library Prep Kit for Illumina (NEB ...
-
bioRxiv - Neuroscience 2022Quote: ... Taq DNA polymerase from New England Biolabs (in the presence of Mn2+) and GeneMorph II Random Mutagenesis Kit from Agilent were used for error-prone PCR ...
-
bioRxiv - Molecular Biology 2022Quote: ... Single-mutant variants of glutamine synthetase were prepared by site-directed mutagenesis using the QuikChange Lightning kit (Agilent technologies, USA). The gene coding for γ-glutamyl phosphate reductase was ligated into the pHTP1 expression vector (GenScript Biotech ...
-
bioRxiv - Molecular Biology 2022Quote: ... AAV-LK03insT and AAV-AM were created by inserting a Threonine or Glycine respectively immediately downstream of the Serine at position 264 of the AAV-LK03 capsid using the QuikChange in vitro mutagenesis kit (Agilent).
-
bioRxiv - Molecular Biology 2022Quote: ... residues N71 and R72 of the σB subunit were replaced by six σA residues (segment 272-KLPAAQ-277) using the Quick Change Lightening site-directed mutagenesis kit (Agilent). Residues 811-825 in the Mtb RNAP β flap were deleted using Quick Change II XL site-directed mutagenesis kit (Agilent) ...
-
bioRxiv - Microbiology 2022Quote: ... Mutations were made on pDUAL plasmids encoding the PR8 gene (64) using a QuikChange II site directed mutagenesis kit (Agilent) according to manufacturer’s instructions ...