Labshake search
Citations for Agilent :
401 - 450 of 2942 citations for Tetratricopeptide Repeat Protein 5 TTC5 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... Protein concentrations were determined using Cary 60 UV spectrophotometer (Agilent) with extinction coefficients and molecular weights calculated by ProtParam (http://web.expasy.org/protparam/).
-
bioRxiv - Cancer Biology 2023Quote: ... Detection of proteins employed goat anti-rabbit IgG (Dako Agilent), goat anti-mouse IgG (Dako Agilent) ...
-
bioRxiv - Neuroscience 2023Quote: ... blocked with DAKO Serum-Free Protein Block (Agilent, cat. #X0909) for 60 min and incubated overnight at 4°C with primary antibodies diluted in DAKO Antibody Diluent (Agilent ...
-
bioRxiv - Cancer Biology 2023Quote: ... Detection of proteins employed goat anti-rabbit IgG (Dako Agilent), goat anti-mouse IgG (Dako Agilent) ...
-
bioRxiv - Cancer Biology 2023Quote: ... After blocking with Protein Block serum-free reagent (Dako #X0909), secondary antibodies were added for 45 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... After blocking with Protein Block serum-free reagent (Dako #X0909), secondary antibodies were added for 45 minutes ...
-
bioRxiv - Cell Biology 2023Quote: Cells were blocked with serum free Protein Block reagent (Dako) at RT for 1hr and stained with primary antibodies diluted in Antibody Diluent (Dako ...
-
bioRxiv - Bioengineering 2024Quote: ... Slides were subsequently incubated with Protein Block (x0909, Agilent Dako) for 1 hour ...
-
bioRxiv - Cell Biology 2024Quote: ... then blocked with protein-free serum block (Agilent, #X090930-2) for 1 hour and incubated at 4 degrees overnight with the corresponding primary antibodies ...
-
bioRxiv - Molecular Biology 2024Quote: ... Blocked with protein block serum-free (catalog no. X0909 Dako) for 211h ...
-
bioRxiv - Bioengineering 2024Quote: ... Slides were subsequently incubated with Protein Block (x0909, Agilent Dako) for 1 hour ...
-
bioRxiv - Immunology 2023Quote: ... and incubated in Protein Block (Dako, Agilent, Santa Clara, CA) for 5 min ...
-
bioRxiv - Immunology 2023Quote: ... and incubated in Protein Block (Dako, Agilent, Santa Clara, CA) for 5 min ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Cancer Biology 2021Quote: ... Incubation with primary antibodies was done in DAKO Antibody diluent with background reducing components (Agilent) at 4°C overnight ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies (Supplementary Table 1A) were diluted in DAKO Antibody diluent (Dako Deutschland, Hamburg, Germany) and subsequently incubated at 4 °C for 24-48 h ...
-
bioRxiv - Pathology 2020Quote: ... Primary antibodies were incubated overnight at 4°C and appropriate HRP-conjugated secondary antibodies (DAKO, Agilent Technologies ...
-
bioRxiv - Developmental Biology 2020Quote: ... Slides were incubated overnight in optimized dilutions of primary antibodies in Antibody Diluent (Dako, S2022). Peroxidase-conjugated anti–goat Ig (Vector ...
-
bioRxiv - Microbiology 2021Quote: ... Following secondary antibodies were used: HRP conjugated goat anti-mouse antibody (#P0447, Dako from Agilent), HRP conjugated goat anti-rabbit antibody (#P0448 ...
-
bioRxiv - Microbiology 2021Quote: ... Following secondary antibodies were used: HRP conjugated goat anti-mouse antibody (#P0447, Dako from Agilent), HRP conjugated goat anti-rabbit antibody (#P0448 ...
-
bioRxiv - Microbiology 2020Quote: ... Primary antibodies were detected with a horseradish peroxidase-conjugated swine anti-rabbit IgG antibody (Dako) and protein bands were visualised using Clarity Western Blot substrate (Biorad ...
-
bioRxiv - Physiology 2022Quote: ... and then incubated in primary antibody diluted in antibody diluent with background reducing component (Dako) overnight at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... Antibodies were diluted to appropriate working concentration using Antibody Diluent (S302283-2, Agilent Technologies Inc).
-
bioRxiv - Cell Biology 2023Quote: ... antibodies to GFP were from Life Technology and secondary antibodies were all from Dako (Denmark).
-
bioRxiv - Pathology 2024Quote: ... the sections were stained with primary antibodies against vimentin (mouse monoclonal antibody, V9; Dako/Agilent), SMA (mouse monoclonal antibody ...
-
bioRxiv - Pathology 2024Quote: ... the sections were stained with primary antibodies against vimentin (mouse monoclonal antibody, V9; Dako/Agilent), SMA (mouse monoclonal antibody ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5-μm sections were obtained and stained with hematoxylin (Dako) and eosin (VWR ...
-
bioRxiv - Neuroscience 2019Quote: ... and QuikChangeII XL Site-Directed Mutagenesis (Agilent Technologies Cat# 200521-5) kits ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples with RIN values > 5 as assessed by TapeStation (Agilent Technologies) were prepared with KAPA mRNA HyperPrep kit (Roche) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Data were collected on a Cytation 5 plate reader (Agilent Technologies) using a green fluorescent polarization filter (excitation and emission wavelengths of 485 nm and 528 nm ...
-
bioRxiv - Neuroscience 2022Quote: ... Images were obtained using a Biotek Cytation 5 Multimode Reader (Agilent) to generate (at minimum ...
-
bioRxiv - Plant Biology 2019Quote: ... GC-separation was achieved on a HP-5 column (Agilent Technologies) using the following temperature gradient ...
-
bioRxiv - Immunology 2020Quote: ... FBXO10 E54K was generated by site-directed mutagenesis (Stratagene 200521-5) using the following primers:
-
bioRxiv - Cell Biology 2022Quote: ... both solvents containing 5 µM Infinity Lab deactivator additive (Agilent Technologies). The elution gradient used was as follows ...
-
bioRxiv - Bioengineering 2022Quote: ... with a 5-Å column (Agilent, 25m x 0.25mm x 30μm). Hydrogen that evolved during the BPEC stabilization stage (see previous section ...
-
bioRxiv - Neuroscience 2022Quote: ... Images were acquired on a Biotek Cytation 5 Multimode Reader (Agilent) with the same gains and exposure across all animals for each stain ...
-
bioRxiv - Systems Biology 2022Quote: ... and desalted via 5 μg C18 columns on an AssayMap (Agilent) following the standard protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... chamber slides were scanned with an automated microscope (Cytation 5, Agilent) with a 4x objective and filters for high-contrast brightfield and GFP fluorescence ...
-
bioRxiv - Cell Biology 2023Quote: ... and Sialidase A (5 mU, Prozyme/Agilent, Santa Clara, CA, USA) overnight at 37°C in order to deglycosylate peptides (Larsen et al ...
-
bioRxiv - Cell Biology 2023Quote: ... and Sialidase A (5 mU, Prozyme/Agilent, Santa Clara, CA, USA) overnight at 37°C in order to deglycosylate peptides (Larsen et al ...
-
bioRxiv - Molecular Biology 2023Quote: ... and a carbohydrate column (4.6 × 150 mm, 5 μm, Agilent Technologies). The sugar concentrations were quantified according to a standard solution (Sigma ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... held for 5 min and connected to the GC-MS (Agilent 7890B GC and 5977 MS ...
-
bioRxiv - Microbiology 2023Quote: ... We exported bacterial growth data from the software (Gen 5, Agilent Technologies ...
-
bioRxiv - Immunology 2023Quote: ... using the Cytation 5 Cell Imaging Reader (Agilent BioTek, CA, USA). Lactate levels present in the samples were estimated from the standard curve.
-
bioRxiv - Bioengineering 2024Quote: ... Cell invasion depth was measured using Gen 5 software (Agilent Technologies), and endothelial microvessel formation was quantified by measuring the average microvessel length at each time point with Fiji (NIH ...
-
bioRxiv - Immunology 2019Quote: ... Diluted monoclonal mouse anti-Ki-67 antibody (TEC-3 antibody [Dako Code M7249]; Dako, Glostrup, Denmark) was then applied and slides incubated overnight at room temperature in a humidified chamber ...
-
bioRxiv - Immunology 2019Quote: ... Diluted monoclonal mouse anti-Ki-67 antibody (TEC-3 antibody [Dako Code M7249]; Dako, Glostrup, Denmark) was then applied and slides incubated overnight at room temperature in a humidified chamber ...
-
bioRxiv - Cancer Biology 2021Quote: ... NUP210 primary antibody (Atlas) was applied at a dilution of 1:100 in antibody diluent (Dako) for 1 hour at room temperature ...
-
bioRxiv - Biochemistry 2022Quote: ... and aSN (primary antibody: anti-Syn-1, BD Transduction Laboratory, secondary antibody: anti-mouse-HRP, Dako). The interaction between endogenous aSN and the endogenous PMCA was studied in the extracts from C57BL/6 mice as described above.
-
bioRxiv - Neuroscience 2020Quote: ... followed by a mouse secondary antibody (rabbit polyclonal anti-mouse biotin antibody, E0413, Dako, 1:200). Histopathological studies of GBM xenograft mice were conducted by Division of Neuropathology ...