Labshake search
Citations for Agilent :
301 - 350 of 2942 citations for Tetratricopeptide Repeat Protein 5 TTC5 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... blocking was performed with serum-free protein block (Dako).
-
bioRxiv - Cancer Biology 2022Quote: ... and a 30-minute protein block (Dako, X090930-2) before incubating with H3K36me3 primary antibody (Abcam ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sections were treated with Protein Block (Dako, #X090930-2) then incubated with primary F4/80 (Cell Signaling Technology ...
-
bioRxiv - Cell Biology 2023Quote: ... pre-incubated with Protein Block Serum-Free (X0909, Dako) for 30 min at room temperature and then exposed to primary antibodies overnight at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... The stained protein was visualized using DAB solution (Dako), and lightly counterstained with Mayer’s hematoxylin ...
-
bioRxiv - Biochemistry 2023Quote: ... Proteins were overexpressed in Escherichia coli BL21(DE3) (Stratagene) in LB as previously described (18) ...
-
bioRxiv - Immunology 2023Quote: ... then blocked using serum-free protein block (Agilent, #X0909) for 10 minutes at RT ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein was concentrated using the StrataClean resin (Agilent Technologies).45 CM volume for StrataClean binding was adjusted to obtain 100µg of total protein ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were blocked using Dako protein block (Agilent Technologies) for 30 minutes ...
-
bioRxiv - Physiology 2023Quote: ... Slides were blocked with serum free protein block (Dako X0909 ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-rabbit Glial Fibrillary Acidic Protein (GFAP, Dako #Z0334) or rabbit anti-LAMP1 (Abcam #24170 ...
-
bioRxiv - Physiology 2024Quote: ... The sections were blocked in protein block solution (DAKO) for 60 min before incubating with antibodies ...
-
bioRxiv - Immunology 2024Quote: ... then blocked using serum-free protein block (Agilent, #X0909) for 10 minutes at RT ...
-
bioRxiv - Immunology 2021Quote: ... then incubated with the primary antibody diluted in Background reducing Antibody Diluent (Agilent). The primary antibody solution was washed by incubating the slides in TBS 0.04% Tween 20 and the sections were incubated with the HRP conjugated secondary antibody for 30 minutes at RT ...
-
bioRxiv - Cancer Biology 2022Quote: ... All antibodies were diluted with Antibody Diluent (with Background Reducing Components, Dako, Germany). Secondary antibodies were applied with ImmPRESS™ HRP (Peroxidase ...
-
bioRxiv - Cancer Biology 2022Quote: ... Slides were incubated with primary antibody diluted in Antibody Diluent (Ref: S2022, Dako) at concentrations indicated in Table S4 ...
-
bioRxiv - Cell Biology 2020Quote: ... Slides were incubated with primary antibodies for pan-cytokeratin antibody (1:100, Dako) and BRCA1 (antibody validation described previously ...
-
bioRxiv - Developmental Biology 2021Quote: ... and all antibodies (Supplemental Table 3) diluted in antibody diluent solution (DAKO, S0809). Secondary staining was performed for 30 min ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Primary antibodies were detected using secondary antibodies coupled to horseradish peroxidase (Dako, Denmark), and detection of the immune complex was performed by chemiluminescent detection (Pierce™ ECL Substrate).
-
bioRxiv - Pathology 2023Quote: ... All antibodies and Streptavidin/HRP were diluted in DAKO Antibody Diluent (S0809, Agilent).
-
bioRxiv - Cell Biology 2023Quote: ... The primary antibodies used were as follows: E-cadherin antibody (M361201-2, Dako), anti-Filaggrin (sc-66192 ...
-
bioRxiv - Immunology 2023Quote: ... and as secondary antibody we used anti-human IgG HRP antibody (Agilent P0214) diluted 1:8,000 in PBS + 1% SM ...
-
bioRxiv - Cancer Biology 2022Quote: ... slices were then incubated with anti-cleaved caspase 3 antibody or anti-Ki67 antibody (Cell Signalling) and further processed with secondary antibody (LSAB2 horseradish peroxidase kit; Dako, Copenhagen, Denmark).
-
bioRxiv - Cancer Biology 2020Quote: ... blocked in 0.5% hydrogen peroxide for 5 minutes at room temperature and then blocked with 20% normal rabbit or goat serum (DAKO, Agilent, Cheadle, Cheshire, UK) for 20 min and incubated with the primary antibody overnight at +4°C ...
-
bioRxiv - Cell Biology 2019Quote: ... Generated tryptic peptides were loaded onto a trap column (300SB-C18, 5 × 0.3 mm, 5-μm particle size; Agilent Technologies, Santa Clara, CA, USA) connected through a zero-dead-volume union to the self-packed analytical column (C18 ...
-
bioRxiv - Cell Biology 2024Quote: ... 2.5 mM calcium chloride for 15 mins at RT prior to examining fluorescence on a Citation 5 microplate reader (Agilent-BioTek, Santa Clara, CA), exciting at 535 nm and measuring emission at 610 nm ...
-
bioRxiv - Microbiology 2020Quote: ... All primary and secondary antibodies were diluted in Dako REAL antibody diluent (Agilent technologies). Images were captured and analysed using a Nikon Eclipse TI microscope with NIS-Elements Microscope Imaging Software (Nikon).
-
bioRxiv - Neuroscience 2021Quote: ... slides were incubated overnight at 4ºC with primary antibodies diluted in antibody diluent (Dako). Following 3×10 minute TBS-T washes ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... The antibodies used were either the rabbit anti-GFAP antibody (Dako Z0334, CA, USA) followed by secondary antibody (donkey anti-rabbit DyLight405 ...
-
bioRxiv - Genetics 2019Quote: ... the following primary antibodies were used: 1) anti-GH rabbit polyclonal antibody (Dako, A0570) (dilution 1:3000) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Immunohistochemistry was performed as previously described with primary antibodies: anti-PCNA antibody (PC10; Dako), anti-pHH3 antibody (IHC-00061 ...
-
bioRxiv - Bioengineering 2023Quote: ... the primary antibodies included rabbit anti-GFAP polyclonal antibody (1:200, Dako, CA, USA) and mouse anti-TUBB3 (1:50 ...
-
bioRxiv - Cell Biology 2023Quote: ... Antibodies were diluted in EnVision Flex Antibody Diluent (Agilent; DM830, Santa Clara, CA, USA), at the dilutions indicated in table 2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... or E2F8 antibody (ab185727, Abcam, 1:500 diluted in Dako REAL Antibody Diluent S2022) overnight or for 60min ...
-
bioRxiv - Cell Biology 2023Quote: ... at RT for 1hr and stained with primary antibodies diluted in Antibody Diluent (Dako) overnight at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated with primary antibodies diluted in background reducing antibody diluent (Agilent S302283-2) overnight at RT ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primary antibody was applied for 35 mins and secondary antibody (Rabbit Envision K4003, Agilent) for 30 minutes ...
-
bioRxiv - Plant Biology 2019Quote: ... using a J&W DB-5 MS column (Agilent Technologies) with the oven program ...
-
bioRxiv - Genomics 2021Quote: ... using 5 μL Fe(III)-NTA cartridges (Agilent, G5496-60085) according to the instructions of the manufacturer ...
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... Reverse primer: 5’GTTGCAGCATGTTTCAGATGAT3’ with paq polymerase 5000 (Agilent, USA) and resulting PCR products were electrophoresed on 3% agarose gel ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Mouse Anti-Enterovirus Clone 5-D8/1 (Dako M7064) to identify CVB VP1 region ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytokeratin 5/6 (mouse monoclonal, clone 6D5/16 B4, Dako), epidermal growth factor receptor (EGFR ...
-
bioRxiv - Cancer Biology 2022Quote: ... C18 cartridges (Agilent, 5 μL bead volume, 150 μg capacity) were primed using 100 μL of 90% acetonitrile and equilibrated with 70 μL of 0.1% TFA at 10 μL/min ...
-
bioRxiv - Bioengineering 2022Quote: Images were captured in Cytation 5 (Agilent, Santa Clara, CA) and processed with ImageJ (NIH ...
-
bioRxiv - Microbiology 2022Quote: ... Fluorescence was measured using a Cytation 5 plate reader (Agilent).
-
bioRxiv - Developmental Biology 2023Quote: ... A 30 m HP-5 MS UI (Agilent J&W) column (0.25 mm ...
-
bioRxiv - Biophysics 2023Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). For the I-/Cl- antiport assay ...
-
bioRxiv - Pathology 2024Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). The fluorescence of SNARF-5F were measured in a time dependent manner using Synergy Neo2 (Agilent/BioTek ...
-
bioRxiv - Biochemistry 2022Quote: ... Product titer was analyzed offline from spent media daily by protein A chromatography on the Agilent Bioinert 1260 HPLC system using a Bio-Monolith Recombinant Protein A column (Agilent Technologies, Santa Clara, CA). An XCell™ ATF system (Repligen ...