Labshake search
Citations for Agilent :
401 - 450 of 500 citations for Rat CPS1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... The obtained amplicons were blunt-cloned into an EcoRV-digested pBluscript KS+ plasmid and transformed into the Sure Escherichia coli strain (Stratagene), cultured at 30 °C.
-
bioRxiv - Neuroscience 2023Quote: ... constructs cloned in AAV-hSyn vectors were transfected with RC/DJ and adenovirus-helper plasmid into the AAV-293 cells (#240073, Agilent) using calcium phosphate precipitation method ...
-
bioRxiv - Microbiology 2022Quote: ... Mutations were made on pDUAL plasmids encoding the PR8 gene (64) using a QuikChange II site directed mutagenesis kit (Agilent) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: Plasmids were transformed and expressed in the Escherichia coli strain BL-21 (DE3) RIL cells (Agilent, Santa Clara, CA, USA). For protein expressions ...
-
bioRxiv - Cell Biology 2022Quote: ... The wild type form of RNAi-resistant MUS81 ORF cloned into the pEF1a-IRES-NEO plasmid was subjected to SDM (Quickchange II XL – Stratagene) to introduce the T86 or S97 mutations ...
-
bioRxiv - Microbiology 2023Quote: ... The resulting pHD1344tub(PAC)-mt-LAF3-Cterm3V5 plasmid was then used as a template for site-directed mutagenesis of D211 (QuikChange II kit; Agilent) using forward and reverse primers listed in Supplemental Table 1 ...
-
bioRxiv - Biophysics 2023Quote: ... derivative encoding two cysteine residues at positions 366 and 511 [constructed from plasmid pGEMD (-Cys)46 by use of site-directed mutagenesis (QuikChange Site-Directed Mutagenesis Kit; Agilent) to replace codons 366 and 511 by a codon encoding cysteine residue] ...
-
bioRxiv - Microbiology 2023Quote: ... A R43A PEXEL mutation in UIS21-70-mNG was generated in this plasmid using a QuikChange Lightning Multi Site Directed Mutagenesis kit (Agilent) and the primer P9 ...
-
bioRxiv - Microbiology 2023Quote: ... All the H2 mutant constructs were subsequently derived from the pEF6-H2R plasmid using a QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent), with mutation accuracy confirmed by sequencing (Genomics Inc. ...
-
bioRxiv - Genetics 2023Quote: ... the Prab-3p::hpk-1 plasmid was used and mutations were performed with a QuikChange II XL Site-Directed Mutagenesis Kit (Agilent). All the assembled plasmids were validated by sequencing prior to microinjection ...
-
bioRxiv - Cell Biology 2023Quote: ... The resulting vectors were subjected to sequencing to ensure that no mutations were introduced into the WRN sequence in the plasmid used for transforming BL21 cells (Stratagene). Expression of GST and GST-fusion proteins were induced upon addition of 1 mM isopropyl-D-thiogalactopyranoside (IPTG ...
-
bioRxiv - Immunology 2023Quote: ... The variable heavy chain sequence of CH42 was subcloned into a plasmid coded with an IgG1 heavy chain backbone containing the N297A 29 mutation via QuikChange Site Directed Mutagenesis kit (Agilent). Antibodies were expressed through co-transfection of heavy and light chain plasmids in Expi293 HEK cells (Thermo Fisher ...
-
bioRxiv - Biochemistry 2023Quote: ... R448A and N455A were introduced in the pETNKI-his-JBP1 JDBD plasmid using a modified QuickChange site-directed mutagenesis method (Agilent). Forward and reverse mutagenesis primers containing the single point mutations were purchased from ThermoFisher Scientific ...
-
bioRxiv - Physiology 2023Quote: ... The cells were transfected with 100 ng of NF-κB firefly luciferase reporter plasmid p(NF-κB)3-Luc (Stratagene) and 10 ng of Renilla luciferase reporter plasmid pRL-RSV (Promega) ...
-
bioRxiv - Neuroscience 2023Quote: ... the corresponding pAAV plasmid construct along with AAV helper plasmids encoding the structural elements were transfected using polyethylenimine (PEI) into the AAV-293 cell line (CVCL_6871, Agilent, USA). The day before transfection ...
-
bioRxiv - Biochemistry 2023Quote: ... Site-directed mutagenesis was performed based on PCR of the full-length plasmid by using Pfu Turbo DNA polymerase (Stratagene). The entire cDNA was sequenced ...
-
bioRxiv - Molecular Biology 2023Quote: ... mutant plasmids encoding the different RNA exosomopathy amino acid substitutions were generated by site-directed mutagenesis of the respective wild-type plasmids (pAC3656, pAC3652, pAC3482) using the QuikChange II Site-Directed Mutagenesis Kit (Agilent) and oligonucleotides containing the desired missense mutations as previously described [33 ...
-
bioRxiv - Microbiology 2024Quote: To detect changes in neutralisation potency single point mutations were introduced into env encoding plasmids for PV production using the QuikChange Lightning Site-Directed Mutagenesis (SDM) kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... The mutations corresponding to the MARylation sites of RACK1 (D144N/E145Q/D203N) were introduced into the pCMV3-RACK1 plasmid using the QuikChange Site-Directed Mutagenesis kit (Agilent).
-
bioRxiv - Cell Biology 2024Quote: The fluorescence from mNG21-10/mNG211 complementation was visualized the day after transfection with the pH2B-mNG211 plasmid using a Cytation 5 microscope (Agilent) equipped with a 20x/0.45 NA phase contrast objective ...
-
bioRxiv - Biochemistry 2024Quote: ... The calibrated concentrations of the cleavage product bands (electrogram peak areas) were used to calculate percent cleavage from total plasmid band intensity using TapeStation Analysis software (Agilent).
-
bioRxiv - Biophysics 2024Quote: ... The pBAD30-ClsA (EE) G51A mutant plasmid was generated from the pBAD30- ClsA (EE) template with QuikChange II Site-Directed Mutagenesis Kit (Agilent). Two residues ...
-
bioRxiv - Biochemistry 2024Quote: All of the mutations were introduced into a plasmid backbone expressing 6xHis tagged pNL4-3-derived IN by QuikChange site-directed mutagenesis kit (Agilent). The plasmids containing full-length WT and mutants were transformed into BL21 (DE3 ...
-
bioRxiv - Microbiology 2024Quote: ... Primers containing the desired deletions and complement were used to amplify the entire plasmid sequence using PfuUltra II fusion HS DNA polymerase (Agilent). After PCR ...
-
bioRxiv - Neuroscience 2020Quote: ... the pT2 5UAS hSNRNP70-eGFP plasmid was used as a template for sequential site directed mutagenesis using QuickChange II (Agilent-200523) to mutate the two nuclear localization signals (NLS ...
-
bioRxiv - Microbiology 2020Quote: Mutations were introduced into a previously described TgMLC1 allelic replacement plasmid (55) using the Quick Change site-directed mutagenesis kit (Agilent Technologies). E.coli were transformed with the mutagenized plasmids and colonies screened by colony PCR and restriction digestion ...
-
bioRxiv - Molecular Biology 2020Quote: ... of the α-peptide sequence of the lacZ gene was amplified using Pfu DNA polymerase with specific primers (AlphaFor, CAGGAAACAGCTATGAC; AlphaRev, CCATTCGCCATTCAGGCTGCGCAA) and pBluescript KS- plasmid (Agilent Technologies) as a template ...
-
bioRxiv - Molecular Biology 2021Quote: ... were prepared by double-stranded plasmid mutagenesis using the primer pairs listed in Table S1 and a Quikchange Site-Directed Mutagenesis Kit (Agilent Tech.). After verification by DNA sequencing ...
-
PHF2 regulates homology-directed DNA repair by controlling the resection of DNA double strand breaksbioRxiv - Molecular Biology 2019Quote: ... Three silent mutations (in capital, gctggaGatCAgGgagcaa) were introduced in the Flag-PHF2 plasmid using the QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies) to make it resistant to siRNA oligonucleotide PHF2#1 (Flag-PHF2*) ...
-
bioRxiv - Molecular Biology 2019Quote: ... plasmid was used and the mutations in amino acid position 339 of KLF1 were introduced by site directed mutagenesis (Agilent Technologies).
-
bioRxiv - Synthetic Biology 2020Quote: ... The plasmid pESC-URA-USER was generated in our lab by adding USER cassette based on the plasmid pESC-URA (#217454, Agilent Technologies) for USER cloning (Nour-Eldin et al. ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the eight genes flanked with the same promoters and terminators were cloned into the 2μ-based high-copy plasmids pESC-URA-USER and pESC-HIS (#217451, Agilent Technologies), resulting in pESC-URA-USER harboring CYP79A2 ...
-
bioRxiv - Neuroscience 2019Quote: All rAAV constructs were generated on backbone plasmid pAAV-CMV-MCS-WPRE-hGH PolyA (modified by cloning WPRE after the MCS in pAAV-MCS, Agilent, USA). Control rAAV constructs were generated as follows ...
-
bioRxiv - Neuroscience 2020Quote: Viral particles of AAV2 were packaged in transfected 293T cells with other two plasmids: pAAV-RC and pAAV-Helper (Agilent Genomics). After harvest ...
-
bioRxiv - Biophysics 2021Quote: ... the HHAT gene was cloned into the pUC19 cloning plasmid and point mutations were introduced by QuikChange™ site-directed mutagenesis (Agilent) and then transferred into pHR-HHAT-Avi-1D4.
-
bioRxiv - Biochemistry 2021Quote: Plasmids encoding AlgE7 variants (Table 2) were constructed based on wild type AlgE7 (plasmid pBG27) (12) using the QuikChange™ Site-directed Mutagenesis Kit (Stratagene/Agilent) or Q5 site directed mutagenesis (New England Biolabs) ...
-
bioRxiv - Biochemistry 2020Quote: ... A plasmid containing eight copies of this 145 bp telomeric DNA was cloned into Sure2 E.coli (Agilent Technologies Singapore Pte. Ltd) following established protocols (32) ...
-
bioRxiv - Biophysics 2021Quote: ... and E217A were cloned with primers IF733 and IF734 using QuikChange Lightning Multi Site-Directed Mutagenesis Kit to generate plasmid pIF585 (Agilent #210516). RAD51(K133R ...
-
bioRxiv - Molecular Biology 2022Quote: ... we created pcDNA3-AhR-1(LBD)-VP16 by site-directed mutagenesis of the pcDNA3-AhR-1-VP16 plasmid with the QuikChange II Site-Directed Mutagenesis Kit (Agilent, 200523). The following primer pair was used to create an L to A substitution at L363 ...
-
bioRxiv - Biochemistry 2022Quote: Deletion of the C-terminal domain and of part of h12 helix (from residue 459 to residue 598) was obtained via mutagenesis of plasmid pET5blpa-Pa-aIF5B according to the QuikChange™ site-directed mutagenesis method (Stratagene). This deletion was designed after inspection of known structures (37 ...
-
bioRxiv - Molecular Biology 2022Quote: ... E197A and D199A were introduced in the parental pcDNA5/FRT/TO-DDX39B plasmid (Galarza- Munoz et al., 2017) using QuickChange Lightning Mutagenesis Kit (Agilent Technologies). All constructs and mutations were confirmed by Sanger sequencing ...
-
bioRxiv - Cancer Biology 2022Quote: ... Point mutants for ENDOD1 and TP53 were converted from parental pLVX-Flag -IRES-ZsGreen1 plasmids using QuikChange Lightning Site-Directed Mutagenesis Kits (Stratagene, 200519). Truncations of ENDOD1 and mutations of TP53 were obtained by fusing different PCR fragments using In-Fusion cloning kit (Clontech ...
-
bioRxiv - Cancer Biology 2022Quote: ... CD58K34A OE plasmids were generated through site-directed mutagenesis of existing CD58 ORF plasmids using the QuikChange XL Site-Directed Mutagenesis Kit (Agilent Technologies) per manufacturer protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... and pDH15-42 were derived from the low copy number (lc) LEU2 PRT1 plasmid p5188 by site-directed mutagenesis of PRT1 using the QuickChange XL kit (Agilent Technologies) and the corresponding primers in Table S2 ...
-
bioRxiv - Biophysics 2021Quote: ... An expression construct for R80A ParB was generated by site-directed mutagenesis of the wild type expression plasmid (QuikChangeII XL, Agilent Technologies). The mutant protein was expressed and purified in the same manner as wild type ...
-
bioRxiv - Molecular Biology 2022Quote: ... pSV-S515D-AR plasmids were synthesised from the pSV-AR template using the QuikChange Lightning Multi Site-directed mutagenesis kit (Agilent Technologies). Mutations were introduced using the following primers ...
-
bioRxiv - Biochemistry 2019Quote: ... hhp1 and hhp2 mutants were created by mutagenizing pIRT2 plasmids containing hhp1+ and hhp2+ using a QuikChange site-directed mutagenesis kit (Agilent Technologies). For protein production ...
-
bioRxiv - Genomics 2021Quote: ... site-directed mutagenesis was performed targeting desired codon positions of the rplD and rplV genes on the pS10 plasmid [20] using the QuikChange Lightning kit (Agilent Technologies) and the primers indicated in Supplemental Table 2 ...
-
bioRxiv - Neuroscience 2023Quote: ... All point mutations of plasmids were generated by Quick Change PCR mutagenesis using Pfu Ultra polymerase (Agilent Technologies, Santa Clara, CA).
-
bioRxiv - Microbiology 2022Quote: ... were generated by site directed mutagenesis on HA-NOD2 plasmid (a gift from Dana Philpott) using the QuickChange II Site-Directed Mutagenesis kit (Agilent Technologies) according to manufacturer’s protocol ...