Labshake search
Citations for Agilent :
401 - 450 of 4080 citations for 1 4 Bis acetyloxy 3 dodecylsulfanyl 2 naphthyl acetate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... bluing buffer (Dako, CS70230-2) for 90 seconds and finally in Eosin Y (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... coli BL21 Rosetta 2 (Stratagene) using the plasmids described above by induction at OD600=0.8 with 1 mM IPTG in 2X YT (Streptavidin-GFP-GFP ...
-
bioRxiv - Physiology 2023Quote: ... 2 μM of FCCP (Agilent), and 0.5 μM of rotenone AA (Agilent ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 2 mM glutamine (Agilent). Cells were allowed to attach at RT for 15 min and then transferred to a 37°C incubator without CO2 for 40 min ...
-
bioRxiv - Cell Biology 2024Quote: ... Diaminobenzidine (Agilent, Cat#K346811-2) was used as a chromogen and finally ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 glutamine (Agilent #103579-100) in XF DMEM medium (Agilent #103575-100)] in atmospheric air at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... pH 9.0 (Agilent, S236784-2) for 10 minutes was used for MMP13 and p16 antigen retrieval ...
-
bioRxiv - Physiology 2023Quote: ... and 2 mM pyruvate (Agilent) and the mitochondria concentration assessed by Pierce BCA Protein Assay (Thermo) ...
-
bioRxiv - Neuroscience 2024Quote: ... Bluing Buffer (Agilent; CS70230-2) was applied to each tissue section until covered and incubated for 2 minutes at room temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... anti-BCL-2 (Dako #M0887) and anti-β-actin (EMD Millipore #MAB1501) ...
-
bioRxiv - Genetics 2024Quote: ... high 9 (Agilent, K800421-2). Sections were immunostained in AutostainerLink 48 from Agilent with EnVision Detection System Peroxidase/DAB ...
-
bioRxiv - Cell Biology 2024Quote: ... and 2 mM glutamine (Agilent)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... the sections were incubated with primary antibody (PRDX2, TFRC or 4-HNE) at 4°C overnight and followed by incubation with secondary antibody FLEX/HRP (Dako) at room temperature for 30 min ...
-
bioRxiv - Cell Biology 2024Quote: ... Step 4 was protein blocking (Background Sniper, Dako Protein Block or Normal block ...
-
bioRxiv - Plant Biology 2020Quote: ... The digest was filtered (0.22 μm) and filtered samples (1-2 μg) were loaded onto a C18 high capacity nano LC chip (Agilent Technologies) using a 1200 series capillary and eluted directly into a 6550 series quadrupole time-of-flight mass spectrometer (Agilent Technologies ...
-
bioRxiv - Neuroscience 2021Quote: ... We used additional microglial markers including mouse anti-MHC-II/HLA-DP/DQ/DR (1:250, M077501-2, Agilent, UK), rabbit anti-PU.1 (1:200 ...
-
bioRxiv - Cell Biology 2021Quote: ... sections were incubated for 2 hours at room temperature with polyclonal guinea pig anti-insulin antibody (1:5, Agilent Technologies). Slides were then washed 3 x 5 minutes with PBS and incubated with the Anti-guinea pig IgG Alexa Fluor 488 (1:200 ...
-
bioRxiv - Molecular Biology 2020Quote: ... were introduced using RE specific primers (Table 1 and Table 2 in supplementary material) by QuickChange Multi site-directed mutagenesis kit (Agilent) according to manufacturer’s instructions.
-
bioRxiv - Neuroscience 2021Quote: ... 25 and 50 ppb with Sc-45 (ICP-MS internal standard mix 1 ug/mL in 2% HNO3, Agilent Technologies) as the internal standard for Cu-63.
-
bioRxiv - Microbiology 2021Quote: Immunofluorescent (IF) staining was performed using the following primary antibodies: polyclonal rabbit anti-HSV-1 (cross-reactive with HSV-2; Agilent), anti-Iba1 (Wako ...
-
bioRxiv - Neuroscience 2020Quote: Total lysate and synaptoneurosomes isolated from cortex tissue of 1-month-old C57Bl/6 mice were UV crosslinked (100 mJ/cm2 for 2 cycles) using UV Stratalinker 2400 (Stratagene) and stored at −80°C until use ...
-
bioRxiv - Neuroscience 2024Quote: ... The cells were washed once with DMEM Assay Medium (XF DMEM [Agilent] supplemented with XF glucose [10 mM, Agilent], XF glutamine [2 mM, Agilent] and XF pyruvate [1 mM, Agilent]), then left in DMEM Assay Medium and placed in a non-CO2 incubator for 1 hour ...
-
bioRxiv - Immunology 2024Quote: ... The membranes were washed and incubated at room temperature for 1 h with rabbit anti-mouse IgG (Agilent, P026002-2) or goat anti-rabbit IgG (Agilent ...
-
bioRxiv - Immunology 2024Quote: ... and MØ cell culture media was replaced with FCS-and bicarbonate-free DMEM medium supplemented with 4.5 mg ml-1 D-glucose and 2 mM glutamine (Agilent, USA) for another 60 min incubation at 37°C without CO2 ...
-
bioRxiv - Genomics 2024Quote: ... We selected for guide integration with 2µg/ml puromycin and then induced prime editor expression with 1 µM doxycycline and determined editing rates by visualizing amplicons (Supplementary Table 2) on the bioanalyzer (Agilent).
-
bioRxiv - Neuroscience 2022Quote: ... Sections were permeabilized with 0.2% Triton X-100 in 2% fish gel for 2 hours at room temperature and immunohistochemically labelled with the primary antibody (1:200 rabbit anti-GFAP, Z0334 Dako; 1:200 rabbit anti-Iba1 ...
-
bioRxiv - Developmental Biology 2023Quote: ... membranes were incubated for 1 h at room temperature with polyclonal goat anti-rabbit secondary antibody IgG/HRP (P044801-2; Agilent Technologies/Dako ...
-
bioRxiv - Developmental Biology 2023Quote: ... with a KpnI site inserted at the 5’ end of Δ3-1 or Δ3-2 (Quick Change Site-Directed Mutagenesis from Stratagene) using the oligonucleotides Δ3-1-KpnI Fw ...
-
bioRxiv - Immunology 2023Quote: ... Cellular sphingolipids were analyzed after extraction with methanol:chloroform (2:1) using a 1290 Infinity II HPLC coupled with a 6495C triple-quadrupole mass spectrometer (Agilent Technologies) as previously described (Naser et al. ...
-
bioRxiv - Immunology 2023Quote: ... and 1-2×105 T cells per well were attached in 5-8 replicates in Seahorse XF RPMI medium (Agilent) supplemented with 2 mM L-glutamine (Gibco) ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were then washed and re-suspended in HBSS with 2% FBS with 1 μg/ml propidium iodide before acquisition on a Novocyte Quanteon or Penteon (Agilent).
-
bioRxiv - Immunology 2024Quote: ... The single and triple-site mutations were introduced into the pcDNA3.1 vector encoding SARS-CoV-2 wildtype or BA.1 Spike using QuickChange site-directed mutagenesis (Agilent 210519) according to the instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... Membranes were washed three times with TBS/T before HRP-coupled secondary antibodies were applied 1:25000 in TBS and incubated for 2 h at RT (Polyclonal rabbit anti-mouse, Dako P0260 ...
-
bioRxiv - Genomics 2020Quote: ... A D1000 Screen Tape assay (Agilent, Cat.5067-5582/3) was used with the 2200 Tape Station (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and endogenous peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 x 2.0 mm Polaris 3 C8-A column (Agilent, Middelburg ...
-
bioRxiv - Microbiology 2024Quote: ... or 3) a HiPlex H column (4.6 x 250mm, Agilent). For 1) ...
-
bioRxiv - Microbiology 2024Quote: ... connected to a BioTek BioStack 3 microplate stacker (Agilent Technologies).
-
bioRxiv - Neuroscience 2023Quote: ... Afterwards the sections were incubated in a humidified chamber (overnight 4°C) in a peroxidase conjugated immunoglobulin against UEA (DAKO, P289; 1:50). Finally ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were incubated for 1h at RT before overnight incubation at 4°C with primary antibodies: Glial Fibrillary Acidic Protein (GFAP) (1/500 Dako Cat. Number Z0334); AQP4 (1/500 ...
-
Retinal affectation in Huntington’s disease mouse models concurs with a local innate immune responsebioRxiv - Neuroscience 2023Quote: ... and incubated overnight in a humid chamber at 4°C with rabbit anti-glial fibrillary acidic protein (GFAP) antibody (1:500, Z0334, DAKO, Agilent, Glostrup, Denmark), rabbit anti-ionized calcium binding adaptor molecule 1 (Iba-1 ...
-
bioRxiv - Neuroscience 2024Quote: ... they were incubated overnight at 4°C with the respective primary antibodies: (i) polyclonal rabbit anti-GFAP (1:2000; Dako, Cat. No. Z0334); (ii ...
-
bioRxiv - Bioengineering 2024Quote: ... The solvent was then diluted with water (DMSO:water = 1:4) and subjected to purification through preparative reverse-phase HPLC chromatography (Agilent 1260 Infinity II HPLC). The chromatographic separation was carried out on an Agilent Prep-C18 column (250 mm × 21.2 mm × 10 μm ...
-
bioRxiv - Bioengineering 2024Quote: ... The solvent was then diluted with water (DMSO:water = 1:4) and subjected to purification through preparative reverse-phase HPLC chromatography (Agilent 1260 Infinity II HPLC). The chromatographic separation was carried out on an Agilent Prep-C18 column (250 mm × 21.2 mm × 10 μm ...
-
bioRxiv - Bioengineering 2024Quote: ... The solvent was then diluted with water (DMSO:water = 1:4) and subjected to purification through preparative reverse-phase HPLC chromatography (Agilent 1260 Infinity II HPLC). The chromatographic separation was carried out on an Agilent Prep-C18 column (250 mm × 21.2 mm × 10 μm ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Cancer Biology 2021Quote: ... W503F (PBD, polo-box domain 1) and H629A, K631M (PBD, polo-box domain 2) were generated by site-directed mutagenesis (Agilent Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... Exome sequencing was performed on genomic DNA from Patients 1 and 2 and their parents using a SureSelect Human All Exon kit (Agilent Technologies) for targeted enrichment ...