Labshake search
Citations for Agilent :
301 - 350 of 4080 citations for 1 4 Bis acetyloxy 3 dodecylsulfanyl 2 naphthyl acetate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... or goat anti-rabbit IgG (250 ng ml−1, 2.5% BSA in PBST; Dako, (Dako, P044801-2) at room temperature for 1 h ...
-
bioRxiv - Neuroscience 2023Quote: ... and β-amyloid analysis (pretreatment with formic acid, antibody 4G8, DAKO, M087201-2, 1:100, 30 minutes). Tau pathology was assessed using Braak criteria (Braak et al ...
-
bioRxiv - Bioengineering 2022Quote: ... anti-mouse-IgG conjugated to horseradish peroxidase (1:10,000, cat. no. P016102-2; Dako, Carpinteria, CA, USA), anti-rabbit StarBright 700 (1:2500 ...
-
bioRxiv - Neuroscience 2024Quote: ... Localization of the GFAP was identified using Anti-GFAP (1:500 dilution; Dako Polyclonal Rabbit Z033429-2), followed by rinsing and incubation with a secondary antibody (Alexa-Fluor 488).
-
bioRxiv - Cell Biology 2024Quote: ... the membranes were incubated with a peroxidase-conjugated secondary anti-rabbit antibody (P039901-2, Agilent, 1:3000) for 1h ...
-
bioRxiv - Microbiology 2024Quote: ... 50 μL samples at a concentration of 2 mg mL-1 were injected onto a HPLC (Agilent), equipped with a WTC 015S5 column ...
-
bioRxiv - Cancer Biology 2024Quote: ... Tissue was counterstained with hematoxylin for 1 minute at room temperature (Agilent Technologies-Dako, Cat S330130-2). For IF ...
-
bioRxiv - Cancer Biology 2024Quote: ... Tissue was counterstained with hematoxylin for 1 minute at room temperature (Agilent Technologies-Dako, Cat S330130-2). For IF ...
-
bioRxiv - Physiology 2020Quote: ... Acetone was measured using an agilent DB-35MS column (30 m 3 0.25mm i.d. 3 0.25 mm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...
-
bioRxiv - Developmental Biology 2024Quote: ... By site-directed mutagenesis the V5 tag of the pMT-Bip V5-His A vector was replaced by a Myc sequence (EQKLISEEDL) using the primers: Fw: 5’– AGCGAAGAGGATCTGACGCGTACCGGTCATCAT–3 and 5’– AATCAGTTTCTGTTCGAATTCCACCACACTGGACTAGTAGGTACC–3’ and the PFU ultra (Agilent). The cDNA for Drospondin without the signal peptide sequence and the stop codon was amplified using the clone GH02025 from Drosophila Genome Resource Center (DGRC) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The hybridisation mix was prepared by mixing the specified amounts of RNA with 10× Gene Expression Blocking Agent (1× final conc.) and 2× Hi-RPM Hybridization Buffer (1× final conc.) (Agilent, Cat No. 5188-5242) in a final volume of 42 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fragment 3 was pBluescript KS (-) (Stratagene, California USA), which was digested using Xba ...
-
bioRxiv - Pathology 2021Quote: ... 3′-diaminobenzidine tetra-hydrochloride chromogen (DAB, K3468, Dako) was added to all sections and the reaction was stopped with distilled water ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2023Quote: ... then labeled using Cyanin-3 CTP (Agilent Technologies) and hybridized on chips containing 45000 probes (4×44K Whole Human Genome) ...
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm 2.7 μm HPLC column (Agilent) with a Poroshell 120 PFP ...
-
bioRxiv - Microbiology 2024Quote: ... anti-Cluster of Differentiation 3 (CD3; Agilent Dako), anti-Paired box protein-5 (Pax-5 ...
-
bioRxiv - Microbiology 2024Quote: ... anti-Cluster of Differentiation 3 (CD3; Agilent Dako), anti-Paired box protein-5 (Pax-5 ...
-
mTOR inhibition enhances delivery and activity of antisense oligonucleotides in uveal melanoma cellsbioRxiv - Cancer Biology 2021Quote: ... or 1 µM (OMM1) carbonyl cyanide 4-(trifluoromethoxy)-phenylhydrazone (FCCP) and 0.5 µM of a rotenone antimycin A mix (Agilent Technologies). Following the assay ...
-
bioRxiv - Neuroscience 2022Quote: ... The plasma (50 µL) was diluted with 150 µL of buffer A (1:4 dilutions, as recommended by Agilent Technologies), and then filtered to remove particulates using a 0.45 μm spin filter (Spin-X centrifuge tube filter ...
-
bioRxiv - Cell Biology 2022Quote: ... Protein immunodetection was performed with primary abs diluted in blocking solution during overnight incubation at 4°C: rabbit polyclonal ab against alpha-1-antitrypsin (A0012, Dako, Agilent) at a 1:500 dilution ...
-
bioRxiv - Physiology 2022Quote: ... for 1 h at RT and incubated overnight at 4°C with 1:100 dilution of mouse anti-Ki67 antibody (Novocastra, Concord, ON, Canada) in antibody diluent (DAKO). Next ...
-
bioRxiv - Developmental Biology 2021Quote: ... Half of the cDNA was amplified for 17 PCR cycles and a 1:4 dilution of the resulting library was assessed by Agilent Bioanalyzer High Sensitivity DNA kit ...
-
bioRxiv - Immunology 2021Quote: ... cells were fixed in 4% PFA and sequentially stained with mAbs to NPM (anti-human/mouse nucleophosmin (NPM) (clone 376, dilution 1:50, Dako) and anti-mouse MPO (Millipore) ...
-
bioRxiv - Bioengineering 2022Quote: ... and incubated overnight at 4 °C with primary antibodies for the glial fibrillary acidic protein (GFAP; 1:1000, Z0334, Dako), ionised calcium-binding adapter molecule 1 (IBA1 ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary antibody incubation was performed overnight at 4 °C with rabbit monoclonal anti-PSyn EP1536Y diluted 1:320,000 in DAKO antibody diluent (Agilent #S0809). After three 5-min washes with PBST ...
-
bioRxiv - Cell Biology 2024Quote: hAC were fixed with 4% formalin and blocked for 1 h at 37°C (Protein-Block serum free, X0909 Dako Agilent). COL2 antibody (MA5-13026 ...
-
bioRxiv - Neuroscience 2023Quote: ... then incubated overnight at 4°C in primary antibodies (RFP from Chromotek 5f8-100 at 1:200, GFAP from Agilent DAKO Z033429-2 at 1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... then incubated overnight at 4°C in primary antibodies (RFP from Chromotek 5f8-100 at 1:200, GFAP from Agilent DAKO Z033429-2 at 1:500 ...
-
bioRxiv - Biochemistry 2023Quote: ... Shimadzu LC-10AT; autosampler: HiP sampler G1367A, T = 4°C, 10 µL injection; flow rate: 1 mL/min; column: Agilent Zorbax Eclipse XDB-C18 80Å ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 μM of carbonylcyanide-4-(trifluoromethoxy)-phenylhydrazone (FCCP) (Seahorse XF Cell Energy Phenotype Test Kit from Agilent or Sigma Aldrich), and 1 μM of antimycin A and rotenone (Sigma Aldrich) ...
-
bioRxiv - Neuroscience 2023Quote: ... and kept at 4°C overnight with primary antibodies (chicken anti-GFP, Aves Labs, 1:4000; rabbit anti-GFAP, Agilent Pathology Solutions ...
-
bioRxiv - Genetics 2023Quote: ... Membranes were labelled with primary antibody for 1 hour at room temperature or overnight at 4°C followed by incubation with HRP-conjugated secondary antibodies (Dako). Membranes were developed using the Western Lightning ECL system (Perkin Elmer) ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were washed with Bond Wash buffer 3 x 30s and then incubated with either mouse anti-CD68 (M0814, 1:100, Dako, Carpenteria, CA), mouse anti-βIII-Tubulin (G7121 ...
-
bioRxiv - Immunology 2024Quote: ... The antigens on the slides were retrieved by submerging slides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent, Cat# S2375) and incubating at 97 °C for 40 min in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Bioengineering 2021Quote: ... were extracted from freeze-dried sludge samples with a 3 h digestion time and 3% sulfuric acid and then analyzed by a gas chromatography-mass spectrometry (GC-MS) (Agilent, USA) with 7890A-5975C model (Lanham et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... the slices were incubated with primary antibodies: rabbit polyclonal anti-PSMA/GCPII (1:150) (M362029-2; DAKO, US), anti-CD68 (1:250 ...
-
bioRxiv - Genomics 2020Quote: ... 1 - 2 ng / µl was examined using a 2100 Bioanalyzer and a corresponding High Sensitivity DNA Kit (Agilent) to determine the MW profile of the size-selected library ...
-
bioRxiv - Immunology 2024Quote: ... sections were stained with monoclonal mouse anti-human CD68 clone PG-M1 - 1:100 (Dako Omnis: GA61361-2). Second antigen retrieval and blocking were performed as described above and subsequent staining was performed with either rabbit anti-Gas6 - 1:100 (PA5-79300 ...
-
bioRxiv - Microbiology 2024Quote: ... sections were blocked for 1 h at room temperature in serum-free blocking buffer (Agilent Technologies, X090930-2), and then incubated with polyclonal rabbit antibody to ASBT (kindly provided by Paul Dawson ...
-
bioRxiv - Neuroscience 2021Quote: ... CD68 (Dako (M087629-2)) 1/200 ...
-
bioRxiv - Cancer Biology 2021Quote: ... anti-BCL-2 (Dako) (M0887) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Myogenin (Dako, IR06761-2), Desmin (Dako ...
-
bioRxiv - Immunology 2022Quote: ... 2 μM FCCP (Agilent) or 1 μM ionomycin (ChemCruz) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Hematoxylin (Agilent CS70030-2) then used to counterstain the nucleus ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 mM glutamine (Agilent), 10 mM D-(+)-galactose) ...