Labshake search
Citations for Agilent :
4401 - 4450 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... After validation by Bioanalyzer analysis quality control (Agilent Technologies), samples were sequenced ...
-
bioRxiv - Immunology 2024Quote: ... RNA was quantified by NanoDrop (Thermo-Fisher) and size distribution was analyzed by using Agilent RNA 6000 Nano kit (Agilent).
-
bioRxiv - Immunology 2024Quote: ... in XF-Base Media (Agilent Technologies) containing 2.5 mM glucose ...
-
bioRxiv - Microbiology 2024Quote: ... Monosaccharides were converted conventionally into the alditol acetates analyzed by GLC on a Maestro (Agilent 7820) chromatograph (Interlab ...
-
bioRxiv - Immunology 2024Quote: ... was captured using a BioTek Cytation 5 Cell Imaging Multimode Reader (Agilent).
-
bioRxiv - Microbiology 2024Quote: ... using a DB–FastFAME capillary column (30 m × 0.25 mm ID × 0.25 µm film) (Agilent Technologies), with helium as the carrier gas ...
-
bioRxiv - Immunology 2024Quote: ... and quality tested by Agilent 2100 Bioanalyzer High Sensitivity DNA assay (Agilent technologies, Santa Clara, CA, USA). Libraries were then prepared for sequencing and sequenced on Illumina NovaSeq6000 (Illumina ...
-
bioRxiv - Microbiology 2024Quote: ... The light source of the RI detector was a G1315B DAD UV detector (Agilent) and wavelength of the laser in the light scattering instrument was set at 658.9 nm ...
-
bioRxiv - Immunology 2024Quote: Oxygen consumption rate (OCR) was measured using Seahorse XFe24 Extracellular Flux Analyzer (Agilent Technologies, California, USA) serving as an indicator for OXPHOS ...
-
bioRxiv - Microbiology 2024Quote: ... coupled with a goat anti-mouse horseradish peroxidase-labelled secondary antibody (Dako Cytomation). To test for SPI-2 functionality membranes were probed first with monoclonal HA.11 IgG antibody (Covance Inc. ...
-
bioRxiv - Microbiology 2024Quote: ... The MxPro qPCR software (Agilent) was used to generate a standard curve and extrapolate the relative preponderance of trypanosomes using the number of Pfr2 copies as a proxy.
-
bioRxiv - Microbiology 2024Quote: ... Data analysis was performed using MassHunter Quantitative Analysis software (version B.10, Agilent Technologies) and confirmed by comparison to authentic standards ...
-
bioRxiv - Microbiology 2024Quote: ... The amplification was performed on a MxPro 3005 (Agilent) with a thermal profile of 95°C for 10 minutes followed by 45 cycles of 95°C for 15 seconds ...
-
bioRxiv - Microbiology 2024Quote: ... The size exclusion analytical column (Bio-SEC-3, Agilent, Santa Clara, CA, USA) was loaded with 50-µl of protein at a concentration of 3.0 mg/ml ...
-
bioRxiv - Immunology 2024Quote: ... RNA was assessed for quality using the BioAnalyzer (Agilent #5067-1513). The SMART-Seq Stranded kit (Takara #634444 ...
-
bioRxiv - Immunology 2024Quote: ... and quality tested by Agilent 2100 Bioanalyzer High Sensitivity DNA assay (Agilent technologies ...
-
bioRxiv - Immunology 2024Quote: ... the target region of the GFP gene was amplified with Pfu-Turbo (Stratagene), cloned into TOPO-PCR4 (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: The integrity of the isolated RNA (according to the aforementioned protocol) was measured with a Fragment Analyzer using RNA Kit 15 nt (Agilent Technologies). Samples with an RNA integrity number ≥ 8 were used for sequencing ...
-
bioRxiv - Immunology 2024Quote: ... and High Sensitivity NGS Fragment Analysis Kit (Agilent Technologies). The final library pool was sequenced on an NovaSeq 6000 (Illumina ...
-
bioRxiv - Immunology 2024Quote: ... The VDJ region (IGHV3-21*06-j4) expressed by Raji was amplified with PfuTurbo (Agilent, catalog # 600252) under the following cycling conditions ...
-
bioRxiv - Immunology 2024Quote: ... Images were stitched using Gen 5 v3.11 software (Agilent, Santa Clara, CA).
-
bioRxiv - Immunology 2024Quote: ... and a High Sensitivity D1000 DNA tape (Agilent) on a Tapestation D4200 (Agilent).
-
bioRxiv - Immunology 2024Quote: ... on a Tapestation D4200 (Agilent).
-
bioRxiv - Immunology 2024Quote: ... Images were stitched using Gen 5 v3.11 software (Agilent, Santa Clara, CA). Red fluorescent intensity was either measured using Gen5 software or ImageJ v1.53t (NIH ...
-
bioRxiv - Immunology 2024Quote: ... green fluorescent and brightfield images were captured with the Cytation1 plate reader (Agilent, Santa Clara, CA) using a 4x objective to capture 2 x 2 image montages in 30-min intervals for 24 hours ...
-
bioRxiv - Immunology 2024Quote: ... Red fluorescent and brightfield images were captured with the Cytation1 plate reader (Agilent, Santa Clara, CA) using a 4x objective to capture 2 x 2 image montages in 1-hour intervals for 24 hours ...
-
bioRxiv - Immunology 2024Quote: ... HER2 CAR-T cells or mock CAR-T cells from the same donor were added at an effector:target cell ratio of 10:1 and measured in a real-time cell analysis assay using the xCELLigence SP system (Agilent, Santa Clara, CA). An electrical current was applied to each co-culture ...
-
bioRxiv - Microbiology 2024Quote: ... and the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA), respectively ...
-
bioRxiv - Microbiology 2024Quote: ... sections were blocked for 1 h at room temperature in serum-free blocking buffer (Agilent Technologies, X090930-2), and then incubated with polyclonal rabbit antibody to ASBT (kindly provided by Paul Dawson ...
-
bioRxiv - Microbiology 2024Quote: ... and the quality of the library was evaluated using the Agilent 5400 system (Agilent, USA). Quantification of the library was achieved through quantitative polymerase chain reaction (QPCR) ...
-
bioRxiv - Microbiology 2024Quote: ... Proteins were revealed by chemi-luminescence (Super Signal West Dura Substrate, Pierce) using a secondary peroxydase-conjugated antibody (Dako) at a dilution of 1:10000 ...
-
bioRxiv - Microbiology 2024Quote: ... The iron content of His6-BufB1 was measured using an inductively coupled plasma - optical emission spectrometer (ICP-OES 5110 VDV, Agilent Technologies). Experimental details are provided in SI Text.
-
bioRxiv - Microbiology 2024Quote: ... Infection curve analysis was conducted by combining 107 CFU/ml of the clinical isolate selected and 108 PFU/ml of the phage selected in 200 µl of LB broth in a 96 well microplate and incubating for 24 h at 37°C in an Biotek Epoch 2 (Agilent). Productive infection was assumed to have taken place when the OD was significantly lower than the control in the exponential phase.
-
bioRxiv - Microbiology 2024Quote: ... grown in a LogPhase600 plate reader (Agilent) at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... RIN scores assessed using a Bioanalyzer (Agilent; 2100 Expert) were >7 ...
-
bioRxiv - Microbiology 2024Quote: ... using a HP-5MSUI column (30 m x 0.25 mm, 0.25 μm; Agilent Technologies 19091S-433UI), methane as the reagent gas (99.999% pure ...
-
bioRxiv - Microbiology 2024Quote: ... Concentrated and dilute samples were analyzed using a GC-MS (Agilent 7890A GC system ...
-
bioRxiv - Microbiology 2024Quote: ... Concentrated and dilute samples were analyzed using a GC-MS (Agilent 7890A GC system, Agilent 5975C MS detector) operating in negative chemical ionization mode ...
-
bioRxiv - Microbiology 2024Quote: ... coli BL21 Gold (DE3) (Stratagene, San Diego, CA, USA) cells harboring an extra plasmid encoding three rare tRNAs (AGG and AGA for Arg ...
-
bioRxiv - Microbiology 2024Quote: ... The Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA) was used to assess RNA integrity ...
-
bioRxiv - Microbiology 2024Quote: ... was performed in a 25 μL reaction mix comprising 1× TaqMan Brilliant II master mix (Agilent, UK), 0.05 pmol/μL forward primer (CCAACCGTGTGTTTCCTCCT) ...
-
bioRxiv - Microbiology 2024Quote: ... the plates were incubated at 25°C with constant shaking and the A360nm was monitored using BioTek Eon plate reader (Agilent). Samples containing only ParA ...
-
bioRxiv - Immunology 2024Quote: ... using Genejammer (Agilent) for virus production ...
-
bioRxiv - Immunology 2024Quote: Extracellular flux experiments were performed using a Seahorse XFe96 Extracellular Flux Analyzer (Seahorse Bioscience). CD8+ T cells were negatively selected using StemCellTM kit (19853 ...
-
bioRxiv - Immunology 2024Quote: ... and fractionated by offline HPLC (Agilent 1220) using basic-pH reverse phase LC (Waters XBridge C18 column ...
-
bioRxiv - Neuroscience 2024Quote: ... and 0.5 µL of rabbit anti-GFAP antibody (Agilent, Z033429-2) diluted in 200 µL of the blocking solution ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA quality was assessed using Agilent 2100 Bioanalyzer (Agilent Technologies Inc. ...
-
bioRxiv - Molecular Biology 2024Quote: ... LC-MS analysis also included a purchased salmon sperm DNA control (sonicated salmon sperm DNA - Agilent #201190).
-
bioRxiv - Neuroscience 2024Quote: ... analyzed and quantified using TapeStation D5000 screening tapes (Agilent) and Qubit HS DNA quantification kit (Thermo Fisher Scientific).
-
bioRxiv - Molecular Biology 2024Quote: ... RNA purity and concentration were assessed using an Agilent 2100 Bioanalyzer RNA Analysis chip (Eukaryote Total RNA Pico Series II) (Agilent Technologies). Quantitative real-time PCR (qPCR ...