Labshake search
Citations for Agilent :
4201 - 4250 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... and quality checked using a genomic Tapestation 4200 (Agilent Technologies). Nanopore libraries were prepared using the Ligation Sequencing Kit (SQK-LSK109) ...
-
bioRxiv - Microbiology 2024Quote: ... GC-MS detection and spectral processing for GC-MS were carried out using the Agilent 7890A GC equipped with an Agilent 5975C VL MSD detector (Agilent Technologies, USA) as described previously (Unemoto et al. ...
-
Co-Metabolic Growth and Microbial Diversity: Keys for the depletion of the α, δ, β and γ-HCH isomersbioRxiv - Microbiology 2024Quote: ... internally coated with a 0.18 µm film composed of a non-polar stationary phase containing 5% diphenyl-polysiloxane (HP5-MS, Agilent). The injection was performed in split-less mode at 280°C ...
-
bioRxiv - Microbiology 2024Quote: ... The final libraries were quantified using the Qubit 1X dsDNA High Sensitivity kit and the Bioanalyzer High Sensitivity DNA kit (Agilent Technologies, Santa Clara, CA, USA). An equimolar pool of libraries was created and sequenced on an Illumina MiSeq instrument with 150bp paired-end reads (SeqCenter ...
-
bioRxiv - Microbiology 2024Quote: ... Amino acid substitutions and deletions were introduced with the QuickChange II Site-Directed mutagenesis kit (Stratagene), according to the manufacturer’s directions.
-
bioRxiv - Microbiology 2024Quote: ... and 1 mL of the supernatant was analyzed with a spectrophotometer (CARY-60, Agilent) at 565 ...
-
bioRxiv - Microbiology 2024Quote: ... Synergy H1 multimode plate reader (Agilent Technologies, Santa Clara, CA). The relative abundance of eDNA was presented as RFU normalized against OD600 of the bacterial culture ...
-
bioRxiv - Microbiology 2024Quote: ... To determine the RNA integrity number the isolated RNA was run on an Agilent Bioanalyzer 2100 using an Agilent RNA 6000 Nano Kit as recommended by the manufacturer (Agilent Technologies, Waldbronn, Germany). Remaining genomic DNA was removed by digesting with TURBO DNase (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... human cGAS was expressed as a fusion protein with a 6×His-SUMO2 tag in Escherichia coli (E. coli) BL21-RIL DE3 (Agilent) bacteria harboring a pRARE2 tRNA plasmid ...
-
bioRxiv - Microbiology 2024Quote: ... the material was analyzed by Agilent Q-TOF 6520-ESI.
-
bioRxiv - Microbiology 2024Quote: ... Fragment sizes were measured using a Femto Pulse (Agilent). A total of eight SMRTbell libraries were prepared from four DNA extractions ...
-
bioRxiv - Microbiology 2024Quote: Content of the rRNA hydrolysate was resolved using Zorbax SB-C18 column (5 µm, 0.5 x 150 mm, Agilent) and the LC conditions were tuned empirically ...
-
bioRxiv - Microbiology 2024Quote: ... The integrity of RNA and removal of ribosomal RNAs was confirmed on a TapeStation (Agilent Technologies). Sequencing libraries were constructed using the TruSeq RNA Sample preparation protocol (Illumina) ...
-
bioRxiv - Microbiology 2024Quote: ... Tissue blocks were sectioned and prepared for immunohistochemistry (Agilent Technologies) as previously described [27] ...
-
bioRxiv - Biophysics 2024Quote: ... were created using a QuikChange site-directed mutagenesis kit (Stratagene). The phosphomimetic mutants of tau were synthesized by Gene to protein ...
-
bioRxiv - Biochemistry 2024Quote: ... mutagenesis was performed using the QuickChange® Lightning Site-Directed Mutagenesis Kit (Agilent) using the forward primer 5’ CAAACAGATTGTGAGTATAACTACTGGGGCCAG 3’ and the reverse primer 5’ AGTTATACTCACAATCTGTTTGTGGACTCCAACCCG 3’ ...
-
bioRxiv - Biochemistry 2024Quote: ... coli BL21 (DE3) competent cells were purchased from Agilent technologies (USA) ...
-
bioRxiv - Biochemistry 2024Quote: ... These mutations were encoded in oligos with flanking BsaI sites and then ordered as a SurePrint Oligonucleotide library (Agilent Technologies)(Table S6) ...
-
bioRxiv - Microbiology 2024Quote: ... Average library size was determined using a Bioanalyser (Agilent Technologies, San Diego, CA, USA) and quantified with a Qubit 3.0 Fluorometer (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... Briefly C1 and E1 cells were seeded in Seahorse XFp Miniplate (Agilent Technologies, Santa Clara, CA, USA) at an optimized concentration of 2×104 cells/well ...
-
bioRxiv - Microbiology 2024Quote: ... EnVision FLEX/ HRP (Dako), was then applied with PolyDetector Liquid DEC (Bio SB) ...
-
bioRxiv - Microbiology 2024Quote: ... Gel electrophoresis using Tapestation 2200 (Genomic DNA and D1000 screentapes, Agilent) was used to validate product size and purity of a subset of DNA extracts ...
-
bioRxiv - Microbiology 2024Quote: ... Gel electrophoresis using Tapestation 2200 and D1000/High sensitivity D1000 screentapes (Agilent, USA) was used to validate product size and purity of a subset of amplicon libraries ...
-
bioRxiv - Microbiology 2024Quote: ... They were separated by reverse phase chromatography with a ZORBAX Eclipse Plus C18 RRHD column (100 by 2.1mm; particle size, and 1.8μm; Agilent Technologies) at 50°C using 10 mM ammonium formate buffer (pH 4.6 ...
-
bioRxiv - Microbiology 2024Quote: ... The QuikChange Lightning Site-Directed Mutagenesis Kit was purchased from Agilent Technologies (Santa Clara ...
-
bioRxiv - Microbiology 2024Quote: ... RNA integrity was measured using a 5400 Fragment Analyzer (Agilent Technologies, Santa Clara, CA, US)) RNA concentration and RNA integrity of the samples can be found in Supplemental Table 1.
-
bioRxiv - Microbiology 2024Quote: ... in which the glutamic acid in the active site was substituted by alanine employing QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies) and appropriate primers listed in SI appendix ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids pLB21 and pLB24 were used to further exchange the minD isoleucine 260 to glutamic acid (I260E) by QuickChange site-directed mutagenesis reaction (Stratagene) with oligonucleotide pair HS205/HS206 ...
-
bioRxiv - Microbiology 2024Quote: ... by incorporation of the corresponding mutation using the QuickChange site-directed mutagenesis reaction (Stratagene) and the oligonucleotide pairs HS320/HS321 and HS322/HS323 ...
-
bioRxiv - Microbiology 2024Quote: ... An XFp Cell Mito Stress Test Kit (Agilent Technologies, Santa Clara, CA) was used per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... cells were incubated for 30 minutes in 5 mM MβCD in fresh XFp medium (Agilent Technologies, Santa Clara, CA). To interrogate mitochondrial function ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA was synthetized using the Affinity Script Multiple Temperature cDNA Synthesis kit (Agilent), following manufacturer’s instructions with oligo-dT primers ...
-
bioRxiv - Neuroscience 2024Quote: ... slices were mounted and cover slipped with fluorescence mounting medium containing DAPI (Dako, Santa Clara, USA).
-
bioRxiv - Neuroscience 2024Quote: ... Prepared libraries were quality-controlled using the Bioanalyzer 2100 (Agilent Technologies, USA) and qPCR-based concentration measurements ...
-
bioRxiv - Neuroscience 2024Quote: ... The sequencing libraries were validated on the Agilent TapeStation (Agilent Technologies, Palo Alto, CA, USA), and quantified by using Qubit 3.0 Fluorometer (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... the RNA ScreenTape and D1000 ScreenTape kits (both from Agilent Technologies), Qubit RNA HS Assay kit ...
-
bioRxiv - Neuroscience 2024Quote: ... and RNA integrity was checked using Agilent TapeStation 4200 (Agilent Technologies, Palo Alto, CA, USA). ERCC RNA Spike-In Mix kit (ThermoFisher #4456740 ...
-
bioRxiv - Neuroscience 2024Quote: Antibody diluent (Agilent Dako REAL, cat. no. S202230)
-
bioRxiv - Evolutionary Biology 2024Quote: The chromatograms were analyzed using the data analysis software package ‘MSD ChemStation F.01.00.1903’ for Windows (Agilent Technologies, Waldbronn, Germany). The area of each peak was determined by integration and the initial threshold of the integration parameters was set on 15 ...
-
bioRxiv - Neuroscience 2024Quote: Protein A/G/L was purchased from Novus Biologicals (NBP2-34985) and diluted to 1ug/ul with antibody diluent solution (DAKO, S080983-2). Two microliters of mouse or human serum/plasma was incubated with NMDAR1-GLUC and 2 ul of protein A/G/L in 1X PBS ...
-
bioRxiv - Neuroscience 2024Quote: ... Wildtype mouse brain paraffin sections were used for IHC analysis with a dilution of mouse serum at 1:200 with antibody diluent solution (DAKO, S080983-2). Mouse anti-NMDAR1 monoclonal antibody (BD ...
-
bioRxiv - Microbiology 2024Quote: ... Samples were analyzed in a HPLC 1100 Series LC System (Agilent Technologies, Palo Alto, USA) coupled to an HTC-Ultra ETD II ion trap mass spectrometer (Bruker Daltonics ...
-
bioRxiv - Microbiology 2024Quote: ... 1.9 µm particles) and analyzed in positive ESI mode by mass spectrometry on an Agilent 6545 Q-ToF mass spectrometer (Agilent, Waldbronn, Germany) as described previously (28,32) ...
-
bioRxiv - Microbiology 2024Quote: Quality control (QC) of total RNA samples was assessed with the Agilent 4200 TapeStation system (Agilent Technologies) using High Sensitivity RNA ScreenTape analysis (Agilent ...
-
bioRxiv - Microbiology 2024Quote: ... using High Sensitivity RNA ScreenTape analysis (Agilent, # 5067-5579) and all RNA samples were confirmed to be of high quality (mean RINe value =9.2 ±0.4 SD) ...
-
bioRxiv - Microbiology 2024Quote: ... An RNA ScreenTape assay was performed on all the samples using TapeStation 4150 to assess RNA integrity (Agilent Technologies). cDNA was synthesized using 1,000ng of the RNA sample and was performed using a High-Capacity cDNA Reverse-Transcription kit from (Applied BioSystems) ...
-
bioRxiv - Microbiology 2024Quote: ... of SspH1 was generated in the pcDNA3::2xHA-SspH1 backbone using the Quikchange II site-directed mutagenesis kit according to the manufacturer’s protocol (Agilent). Briefly ...
-
bioRxiv - Neuroscience 2024Quote: ... Peptide solutions were desalted using the AssayMAP Bravo (Agilent Technologies) platform ...
-
bioRxiv - Neuroscience 2024Quote: ... Peptide solutions were desalted and subjected to phosphoenrichment using the AssayMAP Bravo (Agilent Technologies) platform ...
-
bioRxiv - Neuroscience 2024Quote: ... then quantified with TapeStation® (Agilent Technologies, Santa Clara, CA) and Qubit® (Thermo Fisher Scientific ...