Labshake search
Citations for Agilent :
4001 - 4050 of 5601 citations for Rat CD325 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... Polymerase mutations were created by cloning an N-terminal POL2 PCR fragment into pRS306 and generating the mutations of interest by site directed mutagenesis using the QuickChange Lightning Kit following manufacturer’s instructions (Agilent Technologies). Polymerase mutants were introduced into MATa haploid S ...
-
bioRxiv - Molecular Biology 2021Quote: ... Correspondent seed-sequence mutated Dual-pMIR-report plasmids were obtained using the QuikChange XL Site-Directed Mutagenesis Kit (Agilent Technologies). Low-passage COS7 cells were grown in DMEM (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... the molarity of our libraries was determined using the concentration of our library from Qubit 3.0 Fluorometer (using the Qubit dsDNA high-sensitivity assay kit) and the average library size (bp) using an Agilent Tapestation 2200 (using the Agilent high-sensitivity D1000 ScreenTape and reagents) ...
-
bioRxiv - Microbiology 2020Quote: ... and extracellular acidification rate (ECAR) were measured on Seahorse XF96 analyzer using Seahorse XF Cell Mito Stress Test Kit (Agilent). Briefly ...
-
bioRxiv - Microbiology 2020Quote: ... MinD and ClpX mutant proteins were constructed by site-directed mutagenesis of plasmids containing minD or clpX using the QuickChange II XL Site-directed mutagenesis kit (Agilent) and confirmed by sequencing prior to purification ...
-
bioRxiv - Microbiology 2019Quote: ... The mass spectrometer was calibrated in negative mode prior to data acquisition and mass accuracy during runs was ensured by a continuous infusion of reference mass solution at a flow rate of 0.06 mL/min (API-TOF Reference Mass Solution Kit, Agilent Technologies). Data quality was ensured by multiple injections of standards (with 1.5 µM concentration each ...
-
bioRxiv - Microbiology 2019Quote: All mutated MERS-CoV S constructs were generated by site directed mutagenesis using the QuikChange Lightning site-directed mutagenesis kit (Agilent). pDNA3.1+/MERS-CoV S EMC/2012 served as template for all the mutagenesis performed ...
-
bioRxiv - Microbiology 2020Quote: ... Point mutation of the active site residue Asn145 (Asn145Ala)61 was introduced using the QuikChange II site-directed mutagenesis kit (Agilent) to inactivate the Spd1 DNase (see Supplementary Table S2 for primer sequences) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Exome regions were captured by an Agilent SureSelect Human All Exon V4 Kit and V5+ LincRNA (Agilent Technologies, CA, USA). Sequencing was performed on an Illumina HiSeq 2000 instrument (Illumina ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). The mRNA enrichment ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA integrity was assessed using the Agilent RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent, CA, USA). A total amount of 3 µg RNA per sample was used as input material for the RNA sample preparations ...
-
bioRxiv - Neuroscience 2020Quote: Site-directed insertions were made in GluN1 (GluN1-a) (NCBI Protein database accession no. P35439) or GluN2A (Q00959) subunits with the QuikChange site-directed mutagenesis kit (Agilent) with XL1-Blue super-competent cells ...
-
bioRxiv - Cell Biology 2021Quote: ... The fragment size estimation of the resulting libraries was assessed with High SensitivityTM HS DNA kit runed on 2100 Bioanalyzer (Agilent) and quantified using the QubitTM dsDNA High Sensitivity HS assay (ThermoFisher Scientific) ...
-
bioRxiv - Biophysics 2020Quote: The deletion construct containing the catalytic domain and the interdomain linker (CreCat, residues 127-343) was prepared using QuikChange Site-Directed Mutagenesis Kit (Agilent) from a pET21A vector (Novagen ...
-
bioRxiv - Cell Biology 2020Quote: ... The OCR was then measured with an XF24 Extracellular Flux Analyzer via the XF Cell Mito Stress Kit (Agilent Seahorse). Following 5 measurements of basal OCR ...
-
bioRxiv - Cell Biology 2020Quote: ... were changed to 5′-ACCTGCAAAG −3′ by using the Quick-Change site directed mutagenesis Kit (Stratagene, La Jolla, CA, USA). Expression vectors for SENP2 ...
-
bioRxiv - Biochemistry 2022Quote: ... according to the construct used by the Xia lab [48] was generated by the restriction free cloning method [54] and site-directed mutagenesis (QuickChange Site-Directed Mutagenesis Kit, Agilent). Expression and purification were carried out as described in Tang and Xia [48].
-
bioRxiv - Biophysics 2022Quote: ... pcDNA3-Src K5R/K7R/K9R (Src 3R) mutants were obtained by PCR using the QuickChange Site-Directed Mutagenesis Kit (Stratagene); forward 5’:CCCTTCACCATGGGTAGCAACAGGAGCAGGCCCAGGGATGCCAGCCAGCGGCGCCGC ...
-
bioRxiv - Cancer Biology 2022Quote: ... Glycolytic and mitochondrial ATP production rates were determined according to the XF Real-Time ATP Rate Assay Kit protocol (Agilent). Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... ORF6 mutations were introduced into the pLVX-StrepII-SARS-CoV-2-ORF6-IRES-Puro and pLVX-EF1α-SARS-CoV-2-ORF6-2xStrep-IRES-Puro plasmids using the QuickChange II-XL site-directed mutagenesis kit (Agilent) according to the manufacturer’s instructions using SDM primers listed below ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). RNA quality control was performed using a fragment analyser and standard or high-sensitivity RNA analysis kits (Labgene ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The rRNA-depleted RNAs were converted to paired end libraries using Sure Select Strand Specific RNA Kit (Agilent Technologies, USA) or TruSeq RNA Library Prep Kit v2 (Illumina ...
-
bioRxiv - Cell Biology 2022Quote: ... The vector used for BAF A12T expression was obtained by mutagenesis of the BAF WT expression vector using the Quikchange Site-Directed Mutagenesis kit (Agilent). The lamin A/C Ig-fold construct codes for a GST tag ...
-
bioRxiv - Biochemistry 2022Quote: YedK mutants (C2A, C2A/E105Q, N75A, E105A, E105D, E105Q, H160A) were generated using the QuikChange Site-Directed Mutagenesis Kit (Agilent). The forward and reverse mutagenic extension reactions were performed separately to improve primer annealing ...
-
bioRxiv - Biochemistry 2022Quote: ... and 500 ng of DNAse I-treated total RNA used in enzyme-plus and enzyme-minus reverse transcriptions using the AffinityScript qPCR cDNA Synthesis Kit (Agilent) with oligo(dT ...
-
bioRxiv - Biochemistry 2022Quote: ... All site-directed mutagenesis was performed on this codon-optimized spike clone as the WT form using the QuikChange II Site-directed mutagenesis kit (Agilent), following manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: Oxygen consumption rate (OCR) and extracellular acidification (ECAR) were measured using the Seahorse XF Cell Energy Phenotype Test Kit (Agilent). 12 × 103 cells per well were reverse transfected with siRNA control or targeting SORD in a Seahorse XF24 Cell Culture Microplate (Agilent ...
-
bioRxiv - Molecular Biology 2022Quote: ... The average size of the libraries was determined utilizing Agilent 2100 Bioanalyzer and High Sensitivity DNA Kit (Agilent Technologies, USA), while concentration was assessed using Qubit Fluorometer and dsDNA HS Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... and exonic splicing elements (ΔESE2 and ΔESS3) in IL7R exon 6 were introduced using the QuikChange Lightning Site-Directed Mutagenesis kit (Agilent) following the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2022Quote: ... The D614G amino acid change was introduced into VRC7480 by site-directed mutagenesis using the QuikChange Lightning Site-Directed Mutagenesis Kit from Agilent Technologies (catalog no ...
-
bioRxiv - Immunology 2022Quote: ... Mutations were introduced into VRC7480 either by site-directed mutagenesis using the QuikChange Lightning Site- Directed Mutagenesis Kit from Agilent Technologies (Catalog # 210518) ...
-
bioRxiv - Plant Biology 2022Quote: ... Size profile of the extracted DNA was checked using Femtopulse system genomic DNA 165 kb kit (Agilent Technologies, CA, USA). Eight HiFi SMRTbell® libraries were prepared using the SMRTbell™ Express Template Prep Kit 2.0 according to the manufacturer’s instructions (Pacific Biosciences protocol ...
-
bioRxiv - Systems Biology 2022Quote: ... to remove larger DNA fragments and primer dimers and quality was assessed by Bioanalyzer (Agilent 2100, High Sensitivity DNA kit). Samples were pooled according to indexes for Illumina sequencing.
-
bioRxiv - Pathology 2022Quote: ... The quality and quantity of the RNA samples were analyzed using Agilent 2100 Bioanalyzer with RNA 6000 pico kit (Agilent). Bulk-mRNA sequencing was carried out with these products.
-
bioRxiv - Molecular Biology 2022Quote: ... RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). Sequencing libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB ...
-
bioRxiv - Genomics 2022Quote: ... The library was amplified using 8 PCR cycles and verified on a Fragment Analyzer using the HS NGS fragment kit (Agilent). The library was quantified by qPCR using the KAPA Library quantification kit (Roche ...
-
bioRxiv - Genomics 2022Quote: ... as measured on a 4150 Tapestation System using a High Sensitivity RNA ScreenTape Assay kit (5067-5579/5580, Agilent Technologies), were greater than 8 ...
-
bioRxiv - Microbiology 2022Quote: ... A plasmid encoding inactive RHDV2 3CLpro was generated by substituting the nucleophilic Cys with Ala in the active site of 3CLpro in pcDNA3-RHDV2 using site-directed mutagenesis (Agilent’s Quik Change mutagenesis kit, Agilent, CA) and designated as pcDNA3-RHDV2-m3CLpro ...
-
Metabolic switching and cell wall remodelling of Mycobacterium tuberculosis during bone tuberculosisbioRxiv - Microbiology 2022Quote: ... 1.0 μg of labelled cRNA from each sample and control were used for co-hybridization using the gene expression hybridization kit (Agilent) as per the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: Mutations to delete the αCT11 region (RPRPDDLEI) of GJA1-20k and GJA1-WT was performed using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... RNA integrity and quantification were assessed using the RNA Nano 6000 Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA). RNA sequencing was performed by Novogene (https://en.novogene.com ...
-
bioRxiv - Biochemistry 2022Quote: Point mutation SUR1-K134A was introduced into hamster SUR1 cDNA in pECE using the QuikChange site-directed mutagenesis kit (Stratagene). Mutation was confirmed by DNA sequencing ...
-
Secretin receptor as a target in gastrointestinal cancer: expression analysis and ligand developmentbioRxiv - Cancer Biology 2022Quote: ... The brown staining was then generated by incubation of the sections with Liquid DAB+ Substrate Chromogene Kit (Dako, Glostrup, Denmark) for 2 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... The pCS2HA-HA-LIX1 plasmid was used as template to generate the LIX1 variants in which cysteine 83 and 84 were substituted by serine residues with the QuikChange Site-Directed Mutagenesis Kit (Stratagene) according to the manufacturer’s protocol and the primers listed in supplemental Table S1.
-
bioRxiv - Microbiology 2022Quote: All of the indicated mutations were introduced into a plasmid backbone expressing His6 tagged pNL4-3-derived IN by QuikChange site directed mutagenesis kit (Agilent) (66) ...
-
bioRxiv - Biophysics 2022Quote: ... The insertion of an amber codon (TAG) between E715 and V716 in mGluR2 (azi-ECL2) was performed using the QuikChange site-directed mutagenesis kit (Agilent). SNAP-mGluR2 constructs used for calcium imaging had C-terminal FLAG-tag removed by PCR-based deletion using phosphorylated primers ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Gα subunit plasmids were purchased from cdna.org (Bloomsburg University, Bloomsburg, PA. 4A insertion mutations were introduced to Gα subunits using the QuikChange Mutagenesis Kit (Agilent Technologies) and oligonucleotides (Integrated DNA Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... The quality and size distribution of the DNA was assessed on a Fragment Analyzer using the HS NGS Fragment Kit (Agilent). The pooled samples were then sequenced on a NovaSeq6000 (Illumina ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and Pyrrhocoris apterus samples with the Agilent RNA 6000 Pico Kit on a BioAnalyzer 2100 (Agilent, Santa Clara, United States). T ...
-
bioRxiv - Neuroscience 2021Quote: ... GlyT2 was subcloned into pcDNA3 and the GlyT2 mutants were constructed by site-directed mutagenesis using the QuikChange kit (Stratagene). Plasmids from two independent Escherichia coli colonies were transfected into eukaryotic cells and [3H]glycine transport was measured in the cells for verification ...