Labshake search
Citations for Agilent :
351 - 400 of 6679 citations for hsa mir 32 Real Time RT PCR Detection and U6 Calibration Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: Real-time oxygen consumption rate (OCR) was measured using a Seahorse XF96 Extracellular Flux Analyzer (Agilent) and a Mito Stress Test Kit (Agilent ...
-
bioRxiv - Immunology 2024Quote: Real-time ChIP-qPCR was performed with the Brilliant II SYBR green super mix (Agilent, USA). Forward (AGTGGTGACCTTGAACTTCCC ...
-
bioRxiv - Physiology 2020Quote: ... q-RT-PCR was performed using Brilliant III SYBR Green QPCR Master Mix (Agilent) on the StepOne+ Real-Time PCR system (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1X Brilliant II qRT-PCR mastermix with 1 uL RT/RNase block (Agilent 600825), and 200 nM forward and reverse primer were used ...
-
bioRxiv - Cell Biology 2020Quote: ... Quantitative RT-PCR was performed using the Mx3000P QPCR System (Agilent Technologies, Lexington, MA) with incubation parameters of 2 min at 50°C ...
-
bioRxiv - Immunology 2023Quote: RT-PCR product was QC’ed using the DNA high sensitivity Bioanalyzer Chip (Agilent Technologies). Sample preparation for Illumina deep sequencing was done using the KAPA HyperPrep Kit ...
-
bioRxiv - Cancer Biology 2022Quote: ... The reaction was visualized with the EnVision Detection Kit (DAKO) using diaminobenzidine chromogen as substrate ...
-
bioRxiv - Pathology 2023Quote: ... The reaction was visualized with the EnVision Detection Kit (DAKO) using diaminobenzidine chromogen as substrate ...
-
bioRxiv - Microbiology 2019Quote: ... An external calibration with ESI-L Low Concentration Tuning Mix (Agilent technologies) was performed prior to data collection and internal calibrant Hexakis(1H,1H,3H-tertrafluoropropoxy)phosphazene was used throughout the runs ...
-
bioRxiv - Cell Biology 2021Quote: ... The cartridge sensor was hydrated with 200 μl of calibration solution (Agilent) at 37 °C without CO2 overnight ...
-
bioRxiv - Zoology 2019Quote: ... the sensors cartridges were hydrated at 37°C in calibration solution (Agilent). On the day of the assay ...
-
bioRxiv - Developmental Biology 2019Quote: ... Mutations in the miR-204 binding sites were generated using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) and the mutated sequences were confirmed by DNA sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: ... Site-directed mutagenesis was used to introduce mutations into the putative miR-423-5p binding sites on the Cacna2d2 3’UTR using the QuickChange II XL site-direct mutagenesis kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: cDNA was synthesized from the previously extracted RNA of mice colon tissue by using Affinity Script One-Step RT-PCR Kit (Cat# 600559, Agilent, Santa Clara, CA, USA). RNA was mixed with random 9mer primers ...
-
bioRxiv - Plant Biology 2019Quote: ... was performed by real-time RT-PCR (qRT-PCR) using the BRILLIANT II SYBR® GREEN QPCR Master Mix and the Mx3000P qPCR system (Stratagene, Agilent Technologies Inc. ...
-
bioRxiv - Genetics 2023Quote: ... Rev: TACTTCCAGCCAACCTCGTGAG) were used to perform Quantitative RT-PCR using the Brilliant II SYBR Green QRT-PCR Master Mix (Agilent # 600825) with the following program ...
-
bioRxiv - Physiology 2023Quote: ... followed by Vectastain Elite ABC HRP detection kit (Vector PK-6100) and detection with DAB (Agilent Technologies K346811-2). Cell death and DNA fragmentation were detected with a TUNEL In Situ Cell Death Detection Kit (Roche ...
-
bioRxiv - Cell Biology 2021Quote: Real time directional EC migration was monitored with an xCELLigence RTCA DP instrument (ACEA Biosciences/Agilent Technologies) as previously described (Camillo et al. ...
-
bioRxiv - Plant Biology 2021Quote: ... and real-time qPCR was performed using an Mx3000P Multiplex qPCR system (Stratagene, La Jolla, CA, USA) as described before (Raineri et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... were measured from live cells in real time using Seahorse Extracellular Flux (XF) 24 Analyzer (Agilent Technology). OCR and ECAR were measured simultaneously ...
-
bioRxiv - Cell Biology 2023Quote: ... Seahorse XF Cell Mitostress test and Real-Time ATP Rate Assays (Agilent Technologies, Santa Clara, CA, USA) were used to evaluate mitochondrial function ...
-
bioRxiv - Systems Biology 2023Quote: ... Both OCR and ECAR were subsequently measured in real time using XF96 extracellular flux analyzer (Seahorse Bioscience). The optimized concentration of compounds for mito-stress assay were 1.5 μM of oligomycin ...
-
bioRxiv - Neuroscience 2023Quote: ... ATP production from FO slices was measured using the Seahorse XF Real-Time ATP Rate Assay (Agilent) according to manufacturer instructions with the following modifications ...
-
bioRxiv - Cancer Biology 2023Quote: ... Protein expression was visualised using DAB (Dako Real Envision kit) for 3-5 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... The REAL™ EnVision™ Detection system including anti-rabbit/mouse IgG secondary antibodies and peroxidase/diaminobenzidine (Dako, Agilent Technologies) was used to visualize the primary antibody‑binding cells according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... The REAL™ EnVision™ Detection system including anti-rabbit/mouse IgG secondary antibodies and peroxidase/diaminobenzidine (Dako, Agilent Technologies) was used to visualize the primary antibody‑binding cells according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: RT-PCR was performed in a Stratagene™ Mx3005P qPCR instrument (Agilent Technologies, Waldbronn, Germany) using 10 μl QuantiTec SYBR Green PCR mix (Qiagen) ...
-
bioRxiv - Biochemistry 2019Quote: DSF was performed in a 96-well plate using an Mx3005p RT-PCR machine (Stratagene). Each well (20 µl ...
-
bioRxiv - Physiology 2022Quote: ... qPCR analysis was performed using the Stratagene MX3000P RT-PCR System (Stratagene, La Jolla, CA) in a 25-μL reaction mixture ...
-
bioRxiv - Biochemistry 2020Quote: DSF was performed in a 96-well plate using an Mx3005p RT-PCR machine (Stratagene) with excitation and emission filters of 492 and 610 nm ...
-
bioRxiv - Molecular Biology 2019Quote: ... The metal content was determined using an environmental calibration standard (Agilent 5183-4688), which contains 100x higher concentration of Fe compared to Cu ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples and calibration curves were analyzed using a 1290 Infinitely system from Agilent Technologies (Waldbronn ...
-
bioRxiv - Cancer Biology 2024Quote: ... the sensor cartridge was placed into the calibration buffer medium (Agilent, 100840-000) to hydrate at 37 °C without CO2 overnight ...
-
bioRxiv - Immunology 2022Quote: ... the sections were stained with DAB detection kit (Dako, Copenhagen, Denmark) and hematoxylin ...
-
bioRxiv - Immunology 2019Quote: Real-time oxygen consumption rate (OCR) in macrophages was determined with an XFp Extracellular Flux Analyzer (Seahorse Bioscience). The assay was performed in XF Assay Modified DMEM using 1.6×105 cells/well and 3 wells per condition ...
-
bioRxiv - Molecular Biology 2023Quote: Mitochondrial respiration (OCR and ECAR) was quantified in real-time using the Seahorse extracellular XFe96 flux analyzer (Agilent) for cells from primary skin fibroblast ...
-
bioRxiv - Cancer Biology 2021Quote: ... 32 min-80%) on a 1290 Infinity II (Agilent). The flow rate was maintained at 300 μL/min and the column temperature 25°C ...
-
bioRxiv - Neuroscience 2022Quote: ... 3x 5 minutes) and incubated in the secondary antibody-horseradish peroxidase (HRP) complex as part of REAL EnVision detection system (Dako #K5007) for 1h at RT ...
-
bioRxiv - Biochemistry 2020Quote: Human ISG15 cDNA was amplified by RT-PCR from universal human reference RNA (Agilent 740000-41), adding BamHI and NotI restriction sites at the 5’ and 3’ ends respectively ...
-
bioRxiv - Biochemistry 2020Quote: ... Daily MS calibration was performed with ESI-L Low Concentration Tuning Mix (Agilent Technologies). The internal calibrant was Hexakis(1H,1H,3H-tetrafluoropropoxy)phosphazene (Synquest Laboratories) ...
-
bioRxiv - Bioengineering 2020Quote: ... Calibration was performed using PEG standards of molecular weights up to 300,000 MW (Agilent PEG calibration kit ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The CCS calibration was performed by IM–MS Browser software (Version 10.0, Agilent Technologies). The preprocessed data files were submitted for feature finding ...
-
bioRxiv - Cell Biology 2019Quote: The mitochondrial OCR and ECAR were monitored in vivo in real-time using a Seahorse XF analyzer (XFe24, Agilent). Depending on the experiment ...
-
bioRxiv - Cell Biology 2020Quote: ... qPCR was performed with a minimum of three biological replicates per gene using THUNDERBIRD SYBR qPCR Mix (TOYOBO) according to the manufacturer’s instructions and ran on Mx3000P Real-Time QPCR System (Agilent). Analysis was carried out using double CT method ...
-
bioRxiv - Molecular Biology 2022Quote: Real-time cell metabolic profiling of gastric cell lines was performed with a Seahorse XF HS Mini Analyzer (Agilent). Cells were seeded at the following densities ...
-
bioRxiv - Cancer Biology 2023Quote: xCELLigence experiments were performed using the Real-Time Cell Analyzer (RTCA) Dual Plate (DP) instrument according to the manufacturer’s instructions (Agilent.com). Briefly ...
-
bioRxiv - Cell Biology 2023Quote: Oxygen consumption rates of primary neurons were measured in real-time in an XFe24 Extracellular Flux Analyzer (Seahorse Bioscience; Seahorse Wave Desktop software 2.6.1.56) ...
-
bioRxiv - Microbiology 2021Quote: ... For secondary antibody incubation and signal detection LSAB and AEC Kits (DakoCytomation) were used following the manufacturers protocol ...
-
bioRxiv - Systems Biology 2023Quote: ... The IHC staining was performed with a diaminobenzidine (DAB) detection kit (Dako). The multiplexed IF staining was performed following the instruction of Opal 7-color IHC kit (NEL811001KT ...
-
bioRxiv - Cancer Biology 2023Quote: ... tissues were incubated with secondary antibodies (EnVision Chem Detection Kit, DaKo Cytomation) at room temperature for 30 min ...