Labshake search
Citations for Agilent :
351 - 400 of 3443 citations for Chitinase 3 Like Protein 2 CHI3L2 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... we established an automated 3’UTR-seq (QuantSeq 3’mRNA-seq; Lexogen GmbH, Vienna) using the Agilent NGS Workstation (Agilent Technologies, Santa Clara) at The Centre for Applied Genomics (TCAG ...
-
bioRxiv - Bioengineering 2021Quote: ... All antibodies were diluted in Dako Antibody Diluent (Dako Antibody Diluent S0809; Agilent Technologies). Images were captured by confocal microscopy (Leica DMi8 ...
-
bioRxiv - Neuroscience 2020Quote: ... Primary antibodies were diluted in antibody diluent (Dako) and applied for 45 minutes at room temp ...
-
bioRxiv - Physiology 2022Quote: ... Primary antibodies were diluted in antibody diluent (Dako) and incubated overnight at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... Primary antibodies were diluted in Antibody Diluent (Dako) and a droplet of 25 µl or 50 µl applied on the sample for an 8-well or a coverslip upside down ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primary antibodies were diluted in Antibody Diluent (Dako) and incubated overnight at 4 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... Antibodies were diluted in antibody diluent (Dako, S0809) containing 0.3% Triton X-100 and incubated overnight at 4 °C in a humidified chamber ...
-
bioRxiv - Microbiology 2022Quote: ... αIgG (Agilent Cat#A042402-2). Cells were cultured in RPMI-1640 (Invitrogen) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Krt8/18 (DAKO M365201-2), GATA6 (R&D AF1700 ...
-
bioRxiv - Neuroscience 2021Quote: ... GFAP (Agilent, Cat# Z033429-2) Stained sections with only secondary antibodies were used as controls ...
-
bioRxiv - Neuroscience 2021Quote: ... GFAP (Agilent/Dako, Z033429-2), Lectin (Vector Labs ...
-
bioRxiv - Neuroscience 2021Quote: ... GFAP (Agilent/Dako, Z033429-2), Lectin (Vector Labs ...
-
bioRxiv - Systems Biology 2020Quote: ... pH 9 (Agilent, S236784-2) for 15 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... pH 9 (Agilent, #S236784-2) at 97 °C for 10 min ...
-
bioRxiv - Physiology 2019Quote: ... ACC1/2 (DAKO DENMARK, P0397), phospho-ACC Ser212 (Millipore,03303).HDAC4 (7628 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli BL21 Rosetta 2 (Stratagene) by induction with 1 mM IPTG in 2X YT medium at 20°C overnight ...
-
bioRxiv - Physiology 2021Quote: ... DAB chromogen (Agilent, K346889-2) with hematoxylin counter stain (Agilent ...
-
bioRxiv - Cancer Biology 2021Quote: ... bluing buffer (Dako, CS70230-2) for 90 seconds and finally in Eosin Y (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... coli BL21 Rosetta 2 (Stratagene) using the plasmids described above by induction at OD600=0.8 with 1 mM IPTG in 2X YT (Streptavidin-GFP-GFP ...
-
bioRxiv - Physiology 2023Quote: ... 2 μM of FCCP (Agilent), and 0.5 μM of rotenone AA (Agilent ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 2 mM glutamine (Agilent). Cells were allowed to attach at RT for 15 min and then transferred to a 37°C incubator without CO2 for 40 min ...
-
bioRxiv - Cell Biology 2022Quote: ... pH 9.0 (Agilent, S236784-2) for 10 minutes was used for MMP13 and p16 antigen retrieval ...
-
bioRxiv - Developmental Biology 2023Quote: ... Insulin (1:2, Dako IR002), Integrin-α6 (1:400 ...
-
bioRxiv - Physiology 2023Quote: ... and 2 mM pyruvate (Agilent) and the mitochondria concentration assessed by Pierce BCA Protein Assay (Thermo) ...
-
bioRxiv - Cell Biology 2024Quote: ... Diaminobenzidine (Agilent, Cat#K346811-2) was used as a chromogen and finally ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-BCL-2 (Dako #M0887) and anti-β-actin (EMD Millipore #MAB1501) ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 glutamine (Agilent #103579-100) in XF DMEM medium (Agilent #103575-100)] in atmospheric air at 37°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... membranes were incubated for 1 h at room temperature with polyclonal goat anti-rabbit secondary antibody IgG/HRP (P044801-2; Agilent Technologies/Dako, Santa Clara, 527 CA, United States) diluted 1:2000 in milk ...
-
bioRxiv - Genomics 2020Quote: ... A D1000 Screen Tape assay (Agilent, Cat.5067-5582/3) was used with the 2200 Tape Station (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cytokeratin (AE1/3) and vimentin (V9) were purchased from Dako Agilent Technologies ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and endogenous peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 x 2.0 mm Polaris 3 C8-A column (Agilent, Middelburg ...
-
bioRxiv - Microbiology 2023Quote: ... or 3) a HiPlex H column (4.6 x 250mm, Agilent). For 1) ...
-
bioRxiv - Cancer Biology 2019Quote: ... All antibodies were prepared in antibody diluent from Dako envision kit ...
-
bioRxiv - Immunology 2022Quote: ... Antibodies were diluted in Background Reducing Antibody Diluent (Agilent). The tissue was subsequently incubated with an anti-rabbit HRP polymer (Leica ...
-
bioRxiv - Bioengineering 2021Quote: ... All antibodies were diluted in Dako Antibody Diluent (Dako Antibody Diluent S0809 ...
-
bioRxiv - Immunology 2021Quote: ... Antibodies were diluted in Background Reducing Antibody Diluent (Agilent). The tissue was subsequently incubated with an anti-rabbit HRP polymer (Leica ...
-
bioRxiv - Microbiology 2022Quote: ... primary antibodies and appropriate HRP-conjugated secondary antibodies (DAKO). A chemiluminescence substrate (West Dura ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primary antibodies were diluted in antibody diluent (Agilent; #S3022) and incubated with sections for 16 hours at 4 °C ...
-
bioRxiv - Immunology 2023Quote: ... antibodies were diluted in Background Reducing Antibody Diluent (Agilent) and subsequently incubated with an anti-rabbit HRP polymer (Leica ...
-
bioRxiv - Developmental Biology 2019Quote: ... Dye-swap hybridizations (2+2) were performed on microarray slides (4×44K zebrafish V3, Agilent) using gasket slides and a hybridization chamber and incubated for 17 h at 65°C and 10 rpm in the hybridization oven (Agilent Technologies) ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Immunology 2020Quote: ... proteins were tetramerized with streptavidin-APC (Prozyme) or streptavidin-AlexaFluor488 (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... Proteins were tetramerized with streptavidin-APC (Prozyme), streptavidin–Alexa Fluor 488 (Invitrogen) ...
-
bioRxiv - Neuroscience 2023Quote: ... blocked (30 min, protein block X0909, Dako), and stained overnight at 4°C using primary antibodies detecting F4/80 ...
-
bioRxiv - Immunology 2023Quote: ... using the Protein G AssayMAP Bravo (Agilent) system ...
-
bioRxiv - Immunology 2023Quote: ... using the Protein G AssayMAP Bravo (Agilent) system ...