Labshake search
Citations for Agilent :
251 - 300 of 3443 citations for Chitinase 3 Like Protein 2 CHI3L2 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... Unbound antibody was removed with washing buffer and the fraction of cells with surface protein labeled with CD44 antibody was determined using a MoFlo cell sorter (Dako Cytomation).
-
bioRxiv - Cancer Biology 2021Quote: ... Antibodies were directed against: glial fibrillary acid protein (GFAP; Z0334, rabbit polyclonal, 1:1000 dilution, Dako Agilent, Santa Clara, CA, USA), epithelial membrane antigen (EMA ...
-
bioRxiv - Cancer Biology 2021Quote: ... Antibodies were directed against: glial fibrillary acid protein (GFAP; Z0334, rabbit polyclonal, 1:1000 dilution, Dako Agilent, Santa Clara, CA, USA), epithelial membrane antigen (EMA ...
-
bioRxiv - Bioengineering 2023Quote: ... The supernatants from 1mL transient transfections of the antibodies were purified using the AssayMAP BRAVO platform with 5mL Protein A cartridges (Agilent Technologies). Lager scale transient transfections were purified on the Akta FPLC system using 1mL HiTrap MabSelect PrismA™ affinity chromatography resin (Cytiva) ...
-
bioRxiv - Pathology 2024Quote: ... sections were incubated overnight at 4 ⁰C with a cocktail of the primary antibodies αSyn (clone KM51 1:500, Monosan Xtra, The Netherlands) and glial fibrillary acidic protein (GFAP, Z0334, 1:4000, DAKO, Denmark). After rinsing in PBS ...
-
bioRxiv - Neuroscience 2024Quote: Mouse hind paws were fixed in Zamboni’s fixative for 24-48 hours at 4°C and processed as previously described.44 50 μm floating tissue sections were stained with the primary antibody rabbit anti-protein-gene-product 9.5 (PGP 9.5) (Dako, Z5116, 1:500) overnight and the secondary biotinylated goat anti-rabbit IgG antibody (Vector Laboratories ...
-
bioRxiv - Physiology 2020Quote: ... blocked with 3% BSA in PBS1 and incubated overnight at 4°C with primary polyclonal antibodies for glucagon and insulin (Dako, Agilent, Santa Clara, CA, USA) (Table S8) ...
-
bioRxiv - Physiology 2019Quote: ... and analyzed by Western blotting using the specific first antibodies listed in Supplementary Table 2 with goat anti-rabbit and goat anti-mouse peroxidase-conjugated immunoglobulin as secondary antibodies (Dako). The blots were then processed with the luminescence technique ECL (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... sections were incubated for 2 hours at room temperature with polyclonal guinea pig anti-insulin antibody (1:5, Agilent Technologies). Slides were then washed 3 x 5 minutes with PBS and incubated with the Anti-guinea pig IgG Alexa Fluor 488 (1:200 ...
-
bioRxiv - Cell Biology 2021Quote: ... The membranes were then washed twice with TBS-T followed by incubation for 1 h at room temperature in immunoreaction enhancer solution 2 (Can Get Signal; TOYOBO) with peroxidase-conjugated antibody against rabbit IgG (Dako) as the secondary antibody ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.2% Triton X-100 and incubation with appropriate secondary antibody for 2 hours at room temperature in blocking buffer before washing and mounting in fluorescent mounting medium (DAKO). Images were acquired using a Leica SP8 confocal microscope.
-
bioRxiv - Biophysics 2019Quote: ... anti-surfactant C protein antibody to target membrane antigen secreted from airway type 2 epithelial cells in alveoli or ii) anti-thyroid transcription factor-1 (TTF-1) antibody (Dako Agilent Products ...
-
bioRxiv - Biophysics 2019Quote: ... anti-surfactant C protein antibody to target membrane antigen secreted from airway type 2 epithelial cells in alveoli or ii) anti-thyroid transcription factor-1 (TTF-1) antibody (Dako Agilent Products ...
-
bioRxiv - Microbiology 2021Quote: Immunofluorescent (IF) staining was performed using the following primary antibodies: polyclonal rabbit anti-HSV-1 (cross-reactive with HSV-2; Agilent), anti-Iba1 (Wako ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were permeabilized with 0.2% Triton X-100 in 2% fish gel for 2 hours at room temperature and immunohistochemically labelled with the primary antibody (1:200 rabbit anti-GFAP, Z0334 Dako; 1:200 rabbit anti-Iba1 ...
-
bioRxiv - Developmental Biology 2023Quote: ... membranes were incubated for 1 h at room temperature with polyclonal goat anti-rabbit secondary antibody IgG/HRP (P044801-2; Agilent Technologies/Dako ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.2% Triton X-100 and incubation with appropriate secondary antibody for 2 hr at room temperature in blocking buffer before washing and mounting in fluorescent mounting medium (DAKO). Images were acquired using a Leica SP8 confocal microscope ...
-
bioRxiv - Molecular Biology 2022Quote: 3*10^3 of HPLFs per well were seeded into Seahorse XFe96 well plate (Agilent Technologies, 200941) for overnight ...
-
bioRxiv - Physiology 2020Quote: ... blocked with 3% BSA in PBS1 and incubated overnight at 4°C with primary polyclonal antibodies for glucagon and insulin (Dako, Agilent, Santa Clara, CA, USA) (Table S8) ...
-
Retinal affectation in Huntington’s disease mouse models concurs with a local innate immune responsebioRxiv - Neuroscience 2023Quote: ... and incubated overnight in a humid chamber at 4°C with rabbit anti-glial fibrillary acidic protein (GFAP) antibody (1:500, Z0334, DAKO, Agilent, Glostrup, Denmark), rabbit anti-ionized calcium binding adaptor molecule 1 (Iba-1 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Primary antibodies against proliferating cell nuclear antigen (PCNA-1, 1/200, sc-7907, Santa Cruz; PCNA-2, 1/200, M087901, Dako) were applied overnight at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... for 2hrs at 40°C and then incubated over-night at 4°C on a rotating wheel with 2 μg of anti HBc antibody (Dako B0586). Immune-complexes were captured with protein A/G magnetic beads ...
-
bioRxiv - Neuroscience 2021Quote: The optimal concentration was determined for each antibody: CD3 (polyclonal rabbit – anti-human CD3 IgG, cat. no. A045201-2, Agilent Technologies), 1:60 ...
-
bioRxiv - Cell Biology 2023Quote: ... Secondary antibodies were the following: goat anti-mouse IgG conjugated to horseradish peroxidase (IB: 1:10,000, cat#P044701-2 Dako, Glostrup, Denmark), donkey anti-Rabbit IgG Alexa Fluor 488 (IF ...
-
bioRxiv - Cancer Biology 2024Quote: Sections from primary tumors and the matched axillary node with the largest metastatic focus (≥ 2 mm) were used for assessment of nerves (Neurofilament antibody, DAKO M0762), and angiogenesis markers (Factor-VIII ...
-
bioRxiv - Molecular Biology 2024Quote: ... washed in TBST and incubated for 1-2 h with the peroxidase-coupled secondary antibody (HRP-coupled anti-rabbit IgG (Dako, #P0448), HRP-coupled anti-mouse IgG (Dako ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3′ - Diaminobenzidine (DAB+) solution (DakoCytomation, Glostrup, Denmark), and counterstained by Harris hematoxylin.
-
bioRxiv - Cell Biology 2024Quote: ... Step 3 was endogenous peroxidase blocking (Dako REAL Peroxidase-blocking reagent ...
-
bioRxiv - Immunology 2020Quote: ... protein block (Dako X0909) for 20 minutes at RT ...
-
bioRxiv - Cell Biology 2023Quote: ... and Protein block (Dako) before staining with anti-pS6 (detected with fluorochrome conjugated secondary antibodies ...
-
bioRxiv - Bioengineering 2022Quote: ... Cells were then incubated for 1 hour at room temperature with rabbit anti-glial fibrillary acidic protein (GFAP; rabbit anti-GFAP antibody, 1:300, Dako, Z0334, Carpinteria, CA), rabbit anti-oligodendrocyte specific protein (OSP ...
-
bioRxiv - Bioengineering 2019Quote: ... The following primary antibodies were used for immunocytochemistry experiments: rabbit anti-glial fibrillary acidic protein (GFAP) (DAKO, 1:100, Z-0334, Lot #2002332), mouse anti-vascular endothelial (VE)-cadherin (Abcam ...
-
bioRxiv - Neuroscience 2019Quote: ... and rabbit anti-S100 calcium-binding protein B β-subunit (S100-β) polyclonal antibody (Agilent Dako, Santa Clara, CA, USA Z0311, 1:400). Following washing ...
-
Retinal affectation in Huntington’s disease mouse models concurs with a local innate immune responsebioRxiv - Neuroscience 2023Quote: ... and incubated overnight in a humid chamber at 4°C with rabbit anti-glial fibrillary acidic protein (GFAP) antibody (1:500, Z0334, DAKO, Agilent, Glostrup, Denmark), rabbit anti-ionized calcium binding adaptor molecule 1 (Iba-1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The slides were processed as described and probed with a set of 258 antibodies against total proteins and phosphoproteins using an automated slide stainer Autolink 48 (Dako, Santa Clara, CA). Each slide was incubated with one specific primary antibody and a negative control slide was incubated with antibody diluent without any primary antibody ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were incubated for 1h at RT before overnight incubation at 4°C with primary antibodies: Glial Fibrillary Acidic Protein (GFAP) (1/500 Dako Cat. Number Z0334); AQP4 (1/500 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The slides were processed as described and probed with a set of 264 antibodies against total proteins and phosphoproteins using an automated slide stainer Autolink 48 (Dako, Santa Clara, CA). Each slide was incubated with one specific primary antibody and a negative control slide was incubated with antibody diluent without any primary antibody ...
-
bioRxiv - Developmental Biology 2023Quote: ... Sure 2 (Agilent) competent cells were transformed with the ligation product and cultured at reduced temperatures (27°C) ...
-
bioRxiv - Cancer Biology 2021Quote: ... the membranes were washed 3X with TBST followed by incubation with HRP-conjugated secondary antibodies (Rabbit Cytiva/Amersham NA934; Mouse Agilent/Dako P026002-2) for one hour at room temperature ...
-
bioRxiv - Immunology 2021Quote: ... and bound serum IgG was detected by 70 µL/well of 1:3000 diluted rabbit anti-human IgG antibody linked to horseradish peroxidase (Agilent, P021402-2) incubated for 2h at RT ...
-
bioRxiv - Developmental Biology 2019Quote: ... and incubated for 2 hours at room temperature with a biotinylated goat anti-rabbit secondary antibody (Dako, 1:500 in blocking solution). Cells were washed 3 times and incubated for 30 minutes with streptavidin Cy3 (Sigma ...
-
bioRxiv - Cancer Biology 2022Quote: ... by polymerase chain reaction (PCR). Ki-67 (Catalog no. M7240) and CD4 (Catalog no. M731029-2) antibodies were purchased from Dako (CA, USA). FOXO3a (Catalog no ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2-deoxy-d-glucose (50 mM 2-DG, Agilent Technologies) as a glycolysis inhibitor ...
-
bioRxiv - Cell Biology 2024Quote: ... 3,3’-diaminobenzidine (DAB) substrate (Agilent Cat#GV82511-2 or GV92511-2), Dako REAL Peroxidase-blocking reagent (Agilent S202386-2) ...
-
bioRxiv - Genetics 2019Quote: ... A DNA fragment corresponding to the 700 bp upstream region of the PaPKS1 ORF was amplified with oligonucleotides 5’ tcgccgcggGCTAGGGGGTACTGATGGG 3’ and 5’ cacgcggccgcCTTGGAAGCCTGTTGACGG 3’ (capital letters correspond to P. anserina genomic DNA sequences) and cloned in SKpBluescript vector (Stratagene) containing the nourseothricin-resistance gene Nat in the EcoRV site (vector named P1 ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Physiology 2020Quote: ... Acetone was measured using an agilent DB-35MS column (30 m 3 0.25mm i.d. 3 0.25 mm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...