Labshake search
Citations for Agilent :
351 - 400 of 4126 citations for 8 Benzyloxy 5 R 2 bromo 1 hydroxyethyl 1H quinolinone since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... 2 glutamine (Agilent #103579-100) in XF DMEM medium (Agilent #103575-100)] in atmospheric air at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: Cybrid cells were plated according to manufacturer’s instructions on 8-well Seahorse XFp plates (Agilent, 103010-100). The day of the assay ...
-
bioRxiv - Developmental Biology 2022Quote: ... Hybridization to 8×60K 60mer oligonucleotide spotted microarray slides (Human Mouse Genome, Agilent Technologies, design ID 074809) and subsequent washing and drying of the slides were performed following the Agilent hybridization protocol in Agilent hybridization chambers ...
-
bioRxiv - Physiology 2021Quote: ... Génopole Toulouse Midi-Pyrénées) using Sureprint G3 Mouse GE v2 microarrays (8×60K, design 074809, Agilent Technologies), according to the manufacturer's instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... 200 μl of distilled water was added to the sensor-containing Seahorse 8-well fluxpaks (Agilent Technology), which were coated with Poly-D-Lysine ...
-
bioRxiv - Biochemistry 2019Quote: ... all samples were processed and hybridized to SurePrint G3 Mouse Gene Expression 8 × 60 K (Agilent Technologies). Fluorescence was detected using Agilent DNA Microarray Scanner ...
-
bioRxiv - Neuroscience 2023Quote: Neurospheres were removed from 96-well plates and pipetted into 8-well Seahorse XF HS miniplates (Agilent) coated with 15 µg/mL poly-L-ornithine and 10µg/mL laminin ...
-
bioRxiv - Neuroscience 2023Quote: ... 0-8 min with 0.1% formic acid) and a C-18 column (4.6 × 50 mm, 1.8 μm) (Agilent). Each compound was assessed in triplicate ...
-
bioRxiv - Neuroscience 2023Quote: ... 0-8 min with 0.1% formic acid) and a (C-18 column (4.6 × 50 mm, 1.8 μm) (Agilent). The photoproducts of DEAC-OXM were generated and analyzed in an analogous manner ...
-
bioRxiv - Immunology 2024Quote: Initial experiments were conducted with an 8-well Seahorse XFp extracellular flux analyser (Seahorse Bioscience, Inc, USA) to determine cell seeding density and FCCP concentration (Supplementary Data) ...
-
bioRxiv - Plant Biology 2020Quote: ... The digest was filtered (0.22 μm) and filtered samples (1-2 μg) were loaded onto a C18 high capacity nano LC chip (Agilent Technologies) using a 1200 series capillary and eluted directly into a 6550 series quadrupole time-of-flight mass spectrometer (Agilent Technologies ...
-
bioRxiv - Neuroscience 2021Quote: ... We used additional microglial markers including mouse anti-MHC-II/HLA-DP/DQ/DR (1:250, M077501-2, Agilent, UK), rabbit anti-PU.1 (1:200 ...
-
bioRxiv - Immunology 2022Quote: ... The following antibodies were incubated in 0.1% Triton with 2% goat serum in PBS at 4°C overnight: rabbit anti-GFAP (1: 1000, DAKO, Z0334), rabbit anti-IBA-1 (1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... were introduced using RE specific primers (Table 1 and Table 2 in supplementary material) by QuickChange Multi site-directed mutagenesis kit (Agilent) according to manufacturer’s instructions.
-
Engineering of membrane complex sphingolipids improves osmotic tolerance of Saccharomyces cerevisiaebioRxiv - Bioengineering 2019Quote: ... The dried samples were sent to the Profleader Institute for complex sphingolipids analysis and solubilized in dichloromethane-methanol (2:1,vol/vol) before analysis by UHPLC-QTOF-MS (Agilent) analysis (Fig ...
-
bioRxiv - Neuroscience 2021Quote: ... 25 and 50 ppb with Sc-45 (ICP-MS internal standard mix 1 ug/mL in 2% HNO3, Agilent Technologies) as the internal standard for Cu-63.
-
bioRxiv - Microbiology 2021Quote: Immunofluorescent (IF) staining was performed using the following primary antibodies: polyclonal rabbit anti-HSV-1 (cross-reactive with HSV-2; Agilent), anti-Iba1 (Wako ...
-
bioRxiv - Neuroscience 2020Quote: Total lysate and synaptoneurosomes isolated from cortex tissue of 1-month-old C57Bl/6 mice were UV crosslinked (100 mJ/cm2 for 2 cycles) using UV Stratalinker 2400 (Stratagene) and stored at −80°C until use ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were permeabilized with 0.2% Triton X-100 in 2% fish gel for 2 hours at room temperature and immunohistochemically labelled with the primary antibody (1:200 rabbit anti-GFAP, Z0334 Dako; 1:200 rabbit anti-Iba1 ...
-
bioRxiv - Immunology 2023Quote: ... Cellular sphingolipids were analyzed after extraction with methanol:chloroform (2:1) using a 1290 Infinity II HPLC coupled with a 6495C triple-quadrupole mass spectrometer (Agilent Technologies) as previously described (Naser et al. ...
-
bioRxiv - Microbiology 2023Quote: Pooled gradient fractions were diluted 1:2 with ice-cold PBS and tumbled overnight at 4°C with 50 µl Strataclean resin (Agilent). Beads were pelleted at 600 RCF for 5 min at 4°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... membranes were incubated for 1 h at room temperature with polyclonal goat anti-rabbit secondary antibody IgG/HRP (P044801-2; Agilent Technologies/Dako ...
-
bioRxiv - Neuroscience 2024Quote: ... The cells were washed once with DMEM Assay Medium (XF DMEM [Agilent] supplemented with XF glucose [10 mM, Agilent], XF glutamine [2 mM, Agilent] and XF pyruvate [1 mM, Agilent]), then left in DMEM Assay Medium and placed in a non-CO2 incubator for 1 hour ...
-
bioRxiv - Immunology 2024Quote: ... The membranes were washed and incubated at room temperature for 1 h with rabbit anti-mouse IgG (Agilent, P026002-2) or goat anti-rabbit IgG (Agilent ...
-
bioRxiv - Immunology 2024Quote: ... and MØ cell culture media was replaced with FCS-and bicarbonate-free DMEM medium supplemented with 4.5 mg ml-1 D-glucose and 2 mM glutamine (Agilent, USA) for another 60 min incubation at 37°C without CO2 ...
-
bioRxiv - Genomics 2024Quote: ... We selected for guide integration with 2µg/ml puromycin and then induced prime editor expression with 1 µM doxycycline and determined editing rates by visualizing amplicons (Supplementary Table 2) on the bioanalyzer (Agilent).
-
bioRxiv - Developmental Biology 2019Quote: ... Dye-swap hybridizations (2+2) were performed on microarray slides (4×44K zebrafish V3, Agilent) using gasket slides and a hybridization chamber and incubated for 17 h at 65°C and 10 rpm in the hybridization oven (Agilent Technologies) ...
-
bioRxiv - Molecular Biology 2022Quote: ... at 37°C for 1 hour followed by vehicle or TGF-β (5 ng/ml) and 3000 cells were seeded into Seahorse assay microplates (Agilent Technologies). After 24h of incubation ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were counterstained with DAPI (1:1000 in 1X PBS) for 5 min and coverslipped with fluorescent mounting medium (#S3023, DAKO, Jena, Germany). Images were obtained using an Axioplan M2 fluorescent microscope (Zeiss ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed four times for 5 min each in TBST and incubated with Polyclonal goat anti-mouse (P044701, Agilent, 1:2500) or anti-rabbit (P044801 ...
-
bioRxiv - Molecular Biology 2024Quote: ... then spectrometry readings were collected every 5 min for 1 h using a BioTek Epoch microplate spectrophotometer (Agilent Technologies, Santa Clara, CA).
-
bioRxiv - Neuroscience 2024Quote: OCR assay: Cells were washed and incubated for 1 hour with 180 μL assay medium [in mmol/L: 5 glucose (Agilent #103577-100), 1 pyruvate (Agilent #103578-100) ...
-
bioRxiv - Cell Biology 2020Quote: ... at 5 ng/μl and pBSKS (Stratagene) at 70 ng/μl for a total of 100 ng/μl ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 5 minutes with Liquid DAB (Dako). Samples were counterstained with hematoxilin.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 5 µm (Agilent Technologies, Santa Clara, CA). The following HPLC conditions were used ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μm (Agilent Technologies, Santa Clara, USA) was used for peptide separation ...
-
bioRxiv - Bioengineering 2022Quote: ... 5 μm (Agilent Technologies, Santa Clara, USA) constituted the stationary phase ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... 5 μL of 10X Pfu buffer (Agilent) 1.25 μL of 10 mM dNTP (Thermofisher) ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 μl Fe(III)-NTA cartridges (Agilent) were primed with 100 μL of 0.1% TFA in H2O and equilibrated with 50 μl 0.1% TFA in 80% ACN [37] ...
-
bioRxiv - Cell Biology 2023Quote: ... and Rabbit Anti-Mouse (Dako P044701-5) secondary antibodies were purchased from Agilent ...
-
bioRxiv - Cancer Biology 2023Quote: ... C18 cartridges (Agilent, 5 µL bed volume) were primed with 100 µL 90% acetonitrile (ACN ...
-
bioRxiv - Genetics 2021Quote: ... Two oligos (F: GCGATGCCACCTAGGGCAAGCTGACCCTG and R: CAGGGTCAGCTTGCCCTAGGTGGCATCGC) were used with the QuikChange II mutagenesis kit (Agilent, 200523). We confirmed that this mutation (GFPstop ...
-
bioRxiv - Neuroscience 2019Quote: ... was digested PmeI and the mito-R-Geco fragment was subcloned into EcoRV-digested pBSKII SK+ (Stratagene). Orientation was checked with restriction analysis ...
-
bioRxiv - Cancer Biology 2019Quote: ... The samples were resuspended in 5% formic acid/5% acetonitrile and fractionated over a ZORBAX extended C18 column (Agilent, 5μm particles ...
-
bioRxiv - Microbiology 2019Quote: ... 1% acetonitrile/0.5% formic acid was used as eluent for 5 minutes to trap and desalt the peptides on the enrichment column (Zorbax SB C18, 0.3 × 5 mm, Agilent). An acetonitrile/0.1% formic acid gradient from 5% to 40% acetonitrile was then used within 120 minutes to separate the peptides on a Zorbax 300 SB C18 ...
-
bioRxiv - Cancer Biology 2021Quote: ... W503F (PBD, polo-box domain 1) and H629A, K631M (PBD, polo-box domain 2) were generated by site-directed mutagenesis (Agilent Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... Exome sequencing was performed on genomic DNA from Patients 1 and 2 and their parents using a SureSelect Human All Exon kit (Agilent Technologies) for targeted enrichment ...
-
bioRxiv - Immunology 2022Quote: ... OCR and ECAR were measured at 37°C in Seahorse XF DMEM medium (pH7.4, with 10 mM glucose, 2 mM L-glutamine, and 1 mM sodium pyruvate) (Agilent, 103680-100). 1.5 μM Oligomycin ...
-
bioRxiv - Cell Biology 2023Quote: ... Secondary antibodies were the following: goat anti-mouse IgG conjugated to horseradish peroxidase (IB: 1:10,000, cat#P044701-2 Dako, Glostrup, Denmark), donkey anti-Rabbit IgG Alexa Fluor 488 (IF ...
-
bioRxiv - Immunology 2024Quote: ... 11 cycles of TCR target enrichment PCR 1 and 2 were performed and the resulting cDNA was quantified on an Agilent Bioanalyzer High Sensitivity chip (Agilent Technologies). TCR libraries were prepared and indexed with 9 cycles of amplification using the PN-220103 Chromium i7 Sample Index Plate ...