Labshake search
Citations for Agilent :
451 - 500 of 4126 citations for 8 Benzyloxy 5 R 2 bromo 1 hydroxyethyl 1H quinolinone since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... 2 mM glutamine (103579; Agilent Technologies) and 1 mM sodium pyruvate (103578 ...
-
bioRxiv - Immunology 2023Quote: ... 2 and the QuikChangeII kit (Agilent) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 µl Herc II polymerase (Agilent), and 35 µl nuclease-free water were added to the 40 µl gDNA ...
-
bioRxiv - Microbiology 2024Quote: ... HRP kit (Agilent DAKO, K400111-2) or the EnVision+/HRP ...
-
bioRxiv - Microbiology 2024Quote: ... HRP kit (Agilent DAKO, K400111-2) or the EnVision+/HRP ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 mM L-glutamine (Agilent) and the cells were placed in a non-CO2 incubator set at 37°C for approximately 1 h before starting the assay ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 2 mM XF Glutamine (Agilent), and then cells were incubated in a CO2-free incubator for 1 hr ...
-
bioRxiv - Cancer Biology 2024Quote: ... Serum-Free (Agilent Dako, X090930-2) for 10 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... Serum-Free (Agilent Dako, X090930-2) for 10 minutes ...
-
bioRxiv - Immunology 2024Quote: ... 2 mM glutamine (Agilent, 103579-100), 10 mM glucose (Agilent ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Blots were washed clear of unbound antibody in TBS-T before addition of anti-rabbit-HRP secondary antibody (1:1000 in 5% milk/TBS-T; Agilent Technologies, CA, U.S.A.) for 1 hr at RT ...
-
bioRxiv - Immunology 2022Quote: ... Quality control of the libraries to ensure no adapter dimers were present was carried out by examining 1ul of a 1:5 dilution on a High Sensitivity DNA chip (Agilent Technologies: 5067-4626) on an Agilent 2100 Bioanalyzer ...
-
bioRxiv - Microbiology 2020Quote: ... the primer pair dsbS(H235A)-F/R and a QuikChange II site-directed mutagenesis kit (Stratagene, catalog#:200518) were used ...
-
bioRxiv - Cell Biology 2023Quote: ... These data analysis was performed in the R computing environment and GeneSpring GX software version 13.0 (Agilent Technologies).
-
VPS13B is localized at the cis-trans Golgi complex interface and is a functional partner of FAM177A1bioRxiv - Cell Biology 2023Quote: ... and a randomly selected subset of these embryos was assayed for the target locus disruption through genotyping PCR using vps13b_geno_F/R primers (see Supplementary materials Table S1) and resolving the resulting PCR products on Fragment Analyzer (Agilent).
-
bioRxiv - Systems Biology 2020Quote: ... lyophilized samples were resuspended in Buffer A (5 mM NH4HCO2/ 2% ACN) and 5 mg peptide material (5 mg/ml) was loaded onto a reversed phase column (ZORBAX 300Extend-C18, Agilent). Peptides were separate at a flow rate of 2 ml/min and a constant column temperature of 40 °C using a binary buffer system ...
-
bioRxiv - Biochemistry 2020Quote: ... 50 Pulsed-splitless injection was used to inject 5 μL samples onto an HP-5ms (5%-phenyl)-methylpolysiloxane capillary GC column (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2019Quote: ... Size exclusion chromatography-inductively coupled plasma-mass spectrometry was performed using an Agilent Technologies 1100 Series liquid chromatography system with a BioSEC 5 SEC column (5 μm particle size, 300 Å pore size, I.D. 4.6 mm, Agilent Technologies) and 7700x Series ICP-MS as previously described50 ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Biochemistry 2022Quote: ... SEC profiles for the KWOCAS (Figures 2,3,5 and Supplementary Figure S7) were obtained by high pressure liquid chromatography on an Agilent Bio SEC-5 column (Agilent) at a flow rate of 0.35 mL/min by injection of 10 μL of purified eluate using a mobile phase of Tris-buffered saline (50 mM Tris pH 8 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Secondary antibodies (HRP linked) were swine anti–rabbit (P039901-2) and goat anti–mouse (P044701-2) (DAKO). Imaging was done using SuperSignal West Femto (ThermoFisher ...
-
bioRxiv - Plant Biology 2020Quote: ... Mega BE-C18 (5 g, 20 ml; Agilent), was conditioned with 100 ml of 100% methanol and equilibrated with 50 ml of deionized water ...
-
bioRxiv - Neuroscience 2020Quote: ... with the 5×SRE-Luc reporter plasmid (Stratagene) and EF1αLacZ (β-galactosidase [β-Gal]) ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA Integrity Number (RIN) ≥5 (2100 Bioanalyzer, Agilent), and in the AD group ...
-
bioRxiv - Physiology 2022Quote: ... 5 μm column (Agilent p/n 993967-902). For the HPLC ...
-
bioRxiv - Cancer Biology 2023Quote: ... A BioTek Cytation 5 (Agilent, Santa Clara, CA) was used to take representative images ...
-
bioRxiv - Immunology 2024Quote: ... and 5 µM InfinityLab deactivator additive (Agilent Technologies).
-
bioRxiv - Immunology 2021Quote: ... and bound serum IgG was detected by 70 µL/well of 1:3000 diluted rabbit anti-human IgG antibody linked to horseradish peroxidase (Agilent, P021402-2) incubated for 2h at RT ...
-
bioRxiv - Developmental Biology 2019Quote: ... and incubated for 2 hours at room temperature with a biotinylated goat anti-rabbit secondary antibody (Dako, 1:500 in blocking solution). Cells were washed 3 times and incubated for 30 minutes with streptavidin Cy3 (Sigma ...
-
bioRxiv - Bioengineering 2019Quote: ... followed by overnight staining with 1:300 dilutions of rat-anti-C-peptide (DSHB; GN-ID4-S) and mouse-anti-CD31 (Dako; M082329-2) primary antibodies ...
-
bioRxiv - Neuroscience 2021Quote: ... the co-cultures were incubated first with primary antibody for glial fibrillary acidic protein (GFAP, 1:400, Z033429-2, Dako, Glostrup, Denmark) prepared in 5% NGS in DPBS overnight at +4 following an incubation with Alexa Fluor405 (A31556 ...
-
bioRxiv - Developmental Biology 2020Quote: ... and incubated for 30 minutes at room temperature with the secondary antibody (Supplementary Table 2)(1:500 diluted in DAKO Antibody Diluent). Cells were washed with 0.2% Triton X-100 in PBS ...
-
bioRxiv - Microbiology 2021Quote: ... were designed based on the DNA sequence for SARS-CoV-2 Wuhan-Hu-1 using the QuickChange Primer Design tool (Agilent Technologies, Inc.). Mutagenesis was carried out on a pCDNA-SARs2 Wuhan-Hu 1 S plasmid to create the P681H mutation ...
-
bioRxiv - Cell Biology 2020Quote: Gene expression analysis were performed with Agilent® SurePrint G3 Human GE 8×60K Microarray (Agilent Technologies, AMADID 39494) with the following dual-color design ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA Integrity was ensured by obtaining an RNA Integrity Number - RIN >8 with Agilent 2100 Bioanalyzer (Agilent Technologies, Germany).
-
bioRxiv - Immunology 2022Quote: ... and the resulting peptides were captured and desalted by C-8 trap column (2.1 × 20 mm, Zorbax Eclipse XDB-C8 trap (Agilent) followed by loading on to C-18 column (2.1 × 50 mm in size ...
-
bioRxiv - Physiology 2020Quote: ... 20 μL samples were injected into Hi-Plex H column (300×7.7 mm; 8 μm particle size, Agilent Tech.). 0.1% formic acid in Milli-Q water (Merck Millipore ...
-
LIR-dependent LMX1A/LMX1B autophagy crosstalk shapes human midbrain dopaminergic neuronal resiliencebioRxiv - Cell Biology 2019Quote: Day 30-50 iPSC-derived mDANs were plated according to manufacturer’s instructions on 8-well Seahorse XFp plates (Agilent) previously coated with Poly-L-ornithine and laminin ...
-
bioRxiv - Systems Biology 2021Quote: ... RNA integrity was assessed using an Agilent Bioanalyzer showing a quality RNA integrity number of 8–10 (Agilent Technologies). The RNA was processed using the Illumina TotalPrep RNA Amplification Kit Protocol according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: VIGS-treated barley RNA samples were verified for quality by a Bioanalyzer 2100 instrument and hybridized to the custom 8×16K microarray per the manufacturer’s protocol (Agilent). Sixteen total samples were hybridized ...
-
bioRxiv - Cancer Biology 2023Quote: ... intact poly(A) RNA was purified from 100-500 ng of RNA (RIN 8-10, Agilent Technologies 2200 TapeStation) with oligo(dT ...
-
bioRxiv - Cancer Biology 2022Quote: PBMs were performed on universal ‘all 10-mer’ arrays in 8 x 60K format (GSE AMADID # 030236, Agilent Technologies) essentially as described previously (Berger and Bulyk 2009 ...
-
bioRxiv - Neuroscience 2023Quote: ... plated 3µg/50µl/well onto a 96 well plate with all animals having 6-8 technical replicates (101085-004, Agilent). Mitochondrial-plates were then centrifuged at 2000g ...
-
bioRxiv - Immunology 2023Quote: ... RNA integrity was assessed using an Agilent Bioanalyzer showing a quality RNA integrity number of 8-10 (Agilent Technologies). The RNA was processed using the Illumina TotalPrep RNA Amplification Kit Protocol according to the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and an Agilent 7693A autosampler fitted with a 100 μL gastight syringe was used to inject headspace gas (50 μL) into either a PoraPLOT Q capillary column (25 m, 0.25 mm ID, 8 μm film; Agilent) or a DB-VRX capillary column (20 m ...
-
bioRxiv - Cell Biology 2023Quote: ... was added and analyzed by LC-MS using a PLRP-S 1000A column (8 μm, 50 x 2.1 mm, Agilent) eluting with linear 20-60% ACN-water with constant TFA (0.05% ...
-
bioRxiv - Microbiology 2020Quote: ... Primary antibody solution was then washed out 3x with TBS-T and TBS-T + 5% NFDM + 1:2000 Dako goat anti-rabbit or anti-mouse HRP-conjugated immunoglobulins (Agilent, Santa Clara, CA, USA) was added ...
-
bioRxiv - Biochemistry 2021Quote: ... protein samples were diluted to a final concentration of 5 µM with solvent A and then desalted on a reverse phase-C8 cartridge (Zorbax 300SB-C8, 5 µm, 300 µm ID 5 mm, Agilent Technologies) at a flow rate of 50 μl/min for 3 min with 100 % solvent A and subsequently eluted with 70 % solvent B for MS detection ...