Labshake search
Citations for Agilent :
351 - 400 of 3786 citations for 6 Chloro 3 4 dihydro 4 methyl 3 oxo 2H 1 4 benzoxazine 8 carboxylic Acid d3 Methyl Ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... we washed and cultured BMDMs in the Seahorse XF DMEM medium (pH 7.4) supplemented with 25 mM D-glucose and 4 mM Glutamine (all sourced from Agilent Technologies) for an hour in a non-CO2 incubator at 37 °C ...
-
bioRxiv - Cancer Biology 2024Quote: ... Images were automatically taken every 4 hours over 72 hours in a BioTek BioSpa Automated Incubator (Agilent, Santa Clara, CA). Cell proliferation was quantified using Aligent’s Gen5 image analysis tools.
-
bioRxiv - Cancer Biology 2022Quote: ... Anti-Ki-67 (Antigen Clone TEC-3) antibody (Dako), anti-Cleaved Caspase 3 (Asp175 ...
-
bioRxiv - Immunology 2023Quote: ... the peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... Agilent Bio SEC-3 Column (Agilent Technologies, CA, USA) or HiLoad 16/60 Superdex 200 pg SEC column (GE Healthcare ...
-
bioRxiv - Microbiology 2023Quote: ... using the Bio SEC-3 300A HPLC column (Agilent) and an isocratic elution with 100 mM ammonium acetate (pH 7.0 ...
-
bioRxiv - Genomics 2022Quote: ... we established an automated 3’UTR-seq (QuantSeq 3’mRNA-seq; Lexogen GmbH, Vienna) using the Agilent NGS Workstation (Agilent Technologies, Santa Clara) at The Centre for Applied Genomics (TCAG ...
-
bioRxiv - Biophysics 2024Quote: ... Fluorescence measurements were carried out using 3×3 mm quartz cuvettes (Hellma Analytics, LineaLab, Badalona, Spain) in a Cary Eclipse spectrofluorimeter (Agilent Technologies, Madrid, Spain). Blanks in the absence of protein were routinely measured and subtracted ...
-
bioRxiv - Cancer Biology 2022Quote: ... fixed tissues were embedded in paraffin and 4 mm sections were histologically processed for hematoxylin-eosin staining and immunohistochemistry using anti-human Ki67 antibody (DAKO #M7240, 1:75, 30 min at 37°C). All these procedures were performed using standardized protocols by Atrys Health S.A.
-
bioRxiv - Cancer Biology 2021Quote: ... 4-µm sections were cut and antigen retrieval was carried out by heat treatment with Target Retrieval Solution (S1699, Agilent Technologies) for Ki67 ...
-
bioRxiv - Molecular Biology 2021Quote: ... dilution 1:100)] in TNB blocking buffer for overnight at 4°C followed by one-hour incubation with secondary antibodies: EnVisionTM+ System-HRP (DAKO K4002). TRITC-based Tyramide reagent pack from Perkin Elmer was used to amplify the fluorescence of Ki67 and c-Kit ...
-
bioRxiv - Genetics 2021Quote: ... Samples with a 260/280 nm absorbance ratio > 1.8 and a 260/230 nm absorbance ratio > 2 were labeled and hybridized to the Tomato Gene Expression Microarray 4 × 44K (Agilent Technologies) as previously described (Coppola et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... The sections were incubated with a primary antibody at 4°C overnight and with a rabbit/mouse HRP-conjugated secondary antibody (Dako, Denmark) at room temperature for 2 h ...
-
bioRxiv - Microbiology 2020Quote: ... for 2hrs at 40°C and then incubated over-night at 4°C on a rotating wheel with 2 μg of anti HBc antibody (Dako B0586). Immune-complexes were captured with protein A/G magnetic beads ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were then incubated overnight at +4 °C with primary antibodies diluted in the same solution or in an antibody diluent (Agilent #S3022). The samples were then washed in 0.1 % Triton X-100 or 1.0 % Tween20 in PBS for 30-60 minutes ...
-
bioRxiv - Biochemistry 2020Quote: ... SDM was carried out with appropriate primers (Table 4) using QuikChange® Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA) according to manufacturer’s instruction.
-
bioRxiv - Cell Biology 2021Quote: Primary SVF cells from BAT and sWAT were isolated and cultured for 4 days before being plated in XF cell culture microplates (Seahorse Bioscience). SVF cells (10,000 cells ...
-
bioRxiv - Microbiology 2021Quote: ... qRT-PCR was performed with 4 μl Brilliant III Ultra-Fast SYBR QPCR as instructed by the manufacturer (Agilent Santa Clara). All primers for quantification of either expression of viral m/cRNAs or antiviral responses are shown below.
-
bioRxiv - Biochemistry 2020Quote: ... 100 μl of 2 – 4 mg/ml protein samples were applied to a column using the 1260 Infinity HPLC system (Agilent Technologies) coupled to a MiniDawn Treos detector (Wyatt Technologies ...
-
bioRxiv - Genetics 2022Quote: ... and incubated in the dark overnight at 4 C before running on a Novocyte Quanteon flow cytometer using NovoExpress 1.3.0 software (Agilent, Santa Clara, CA) at a flow rate of 14 uL/minute ...
-
bioRxiv - Pathology 2020Quote: ... Primary antibodies were incubated overnight at 4°C and appropriate HRP-conjugated secondary antibodies (DAKO, Agilent Technologies, Santa Clara, CA, USA) for 1 hour at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... at 4°C overnight followed by incubation with Dako EnVision+System-HRP Labelled Polymer Anti-Mouse (Aglient Dako, Cat # K400111-2) for 60 min at room temperature ...
-
bioRxiv - Biochemistry 2021Quote: ... or PDK1SKD-PIF S241A (4 mg/ml) was injected onto a Superdex 200 10/300 column (Cytiva) operated by a 1260 Infinity HPLC (Agilent Technologies). Light scattering of a 690 nm laser was detected by a MiniDawn Treos (Wyatt ...
-
bioRxiv - Cell Biology 2020Quote: ... All hESC lines were analysed for their genetic content by array-based comparative genomic hybridization (Human Genome CGH Microarray 4×44K, Agilent Technologies) as previously described (Jacobs et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were fixed for 15 min in 4% paraformaldehyde and blocked for 60 min in blocking solution (DAKO, Mississauga, Ontario, Canada). Sections were incubated overnight in polyclonal rabbit anti-GFAP primary antibody and monoclonal mouse anti-tau antibody (DC190) ...
-
bioRxiv - Cancer Biology 2022Quote: Genome-wide copy number variations were assessed using the SurePrint G3 Human aCGH 4×180K Microarray (Agilent Technologies, Santa Clara, CA), according to the manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were post-fixed with 4% formaldehyde for 10 minutes and histologically stained with Dako Mayers hematoxylin (Agilent, cat. no. S3309) (4 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... solution (pH 7.4) and incubated with goat anti-mouse or anti-rabbit immunoglobulin labeled with dextran molecules and horseradish peroxidase (EnVision, Dako Omnis) at room temperature for 30 min ...
-
bioRxiv - Genomics 2023Quote: Each purified GST-tagged DBD stock was validated for DNA-binding specificity using 4×44k universal protein-binding microarrays (PBMs) (Agilent Technologies), as described previously42 ...
-
bioRxiv - Bioengineering 2023Quote: ... equipped with a UV detector through a C18 column Poroshell 120 EC-C18 (4.6 × 150 mm, 4 μm) (Agilent Technologies, Inc.). Mobile phase consisted of acetonitrile/methanol/0.4% acetic acid/ tetrahydrofuran (80:12:5:3 ...
-
bioRxiv - Cancer Biology 2023Quote: The 4-6um thick TMA sections were deparaffinized and antigens were unmasked using EnVision FLEX Target Retrival Solution Low pH (Dako Agilent) in PT link device (PT200 ...
-
bioRxiv - Neuroscience 2023Quote: ... for 60 min and incubated overnight at 4°C with primary antibodies diluted in DAKO Antibody Diluent (Agilent, cat. #S080983-2). Sections were washed in PBS (3 x 5 min ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were fixed for 15 min in 4% paraformaldehyde and blocked for 60 min in a blocking solution (DAKO, Ontario, Canada). Sections were incubated overnight in a polyclonal rabbit anti-IBA-1 primary antibody (1:1000 ...
-
bioRxiv - Pathology 2023Quote: ... consecutive 4-μm slices of human aspirated thrombi were immunohistochemically stained using antibodies against CD34 (mouse monoclonal, clone QBEnd10; Dako/Agilent), FXI (LSBio) ...
-
bioRxiv - Neuroscience 2024Quote: ... then stained with DAPI for 10 minutes at room temperature followed by 4 x 5-minutes washes in 1X PBS before being mounted using antifade fluorescence mounting media (Dako, S3023).
-
bioRxiv - Cell Biology 2024Quote: Cy3-labeled cRNAs were further hybridized onto Agilent Whole Human Genome kit 4 x 44K slides (Catalog number G4112F, Agilent Technologies) containing 44,397 oligonucleotide probes in 2X Hi-RPM Hybridization buffer (Catalog number 5188-5242 ...
-
bioRxiv - Microbiology 2024Quote: ... Plates were stacked without lids and the OD600 was recorded every hour for 24 hours using a stacker (Biostack 4, Agilent BioTek) and plate reader (Epoch 2 ...
-
bioRxiv - Neuroscience 2024Quote: ... Sections were incubated in primary antibodies overnight at 4 °C (Figure S2) and in secondary antibody-horseradish peroxidase complex (REAL EnVision detection kit, Dako #K5007) for 1 h at RT ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and the stock solution was stored anaerobically at 4°C after its concentration was verified using inductively coupled plasma mass spectrometry (ICP-MS; Agilent 7800). Negligible oxidation of arsenite to arsenate was confirmed prior to use by high-performance liquid chromatography (HPLC ...
-
bioRxiv - Microbiology 2024Quote: ... Plates were stacked without lids and incubated at 37 °C for 24 h in a stacker-incubator system (Biostack 4, Agilent BioTek) connected to a plate reader (Epoch 2 ...
-
bioRxiv - Genomics 2020Quote: ... A D1000 Screen Tape assay (Agilent, Cat.5067-5582/3) was used with the 2200 Tape Station (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and endogenous peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 x 2.0 mm Polaris 3 C8-A column (Agilent, Middelburg ...
-
bioRxiv - Microbiology 2024Quote: ... or 3) a HiPlex H column (4.6 x 250mm, Agilent). For 1) ...
-
bioRxiv - Microbiology 2024Quote: ... connected to a BioTek BioStack 3 microplate stacker (Agilent Technologies).
-
bioRxiv - Genomics 2020Quote: ... Adapter-ligated DNA was amplified for 6-8 cycles using Herc II Fusion DNA polymerase (Agilent). PCR products were purified with AMPure XP beads and subjected to Illumina paired-end sequencing (2x 75 bp).
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Plant Biology 2021Quote: ... needles and green stem) of 4 individual clonal Pinus radiata trees using the Plant RNA Isolation Mini Kit (Agilent, Santa Clara, CA). 50 mg of plant material from each tissue type were used for the RNA extractions ...