Labshake search
Citations for Agilent :
251 - 300 of 3786 citations for 6 Chloro 3 4 dihydro 4 methyl 3 oxo 2H 1 4 benzoxazine 8 carboxylic Acid d3 Methyl Ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... The (Cy3)-cRNA samples were hybridized to Agilent mouse 4 × 44 K-format oligonucleotide microarrays (Agilent Technologies). The slides were washed according to the manufacturer’ s instructions and scanned with an Agilent DNA microarray scanner.
-
bioRxiv - Neuroscience 2022Quote: ... P1.SCPN (4)) were evaluated for quality on the Agilent TapeStation (Agilent Technologies, Palo Alto, CA, USA), quantified using Qubit 2.0 Fluorometer (Invitrogen ...
-
bioRxiv - Pathology 2021Quote: ... OD600 was measured every hour for 24 hours in a BioTek Synergy 4 microplate reader (BioTek-Agilent). In vitro growth graphs were generated using ggplot2 and ggprism ...
-
bioRxiv - Physiology 2023Quote: ... The plate was immediately loaded into a Biotek Synergy 4 96-well plate reader (Agilent Technologies, USA), and NADPH fluorescence (340/460 excitation/emission ...
-
bioRxiv - Microbiology 2023Quote: ... TIMS dimension was calibrated linearly using 4 selected ions from ESI Low Concentration Tuning Mix (Agilent Technologies) [m/z ...
-
bioRxiv - Cell Biology 2024Quote: ... 15000 cells were seeded in biological replicates (n=4) into 96 well seahorse cell culture microplates (Agilent) pre-treated with fibronectin (5 μg/mL) ...
-
bioRxiv - Microbiology 2024Quote: ... 4-CP and phenol were measured using a high-Performance Liquid Chromatograph (HPLC, model: 1100, Agilent, USA) equipped with a 250 nm diode array detector (DAD ...
-
bioRxiv - Genomics 2024Quote: ... Chromatin was collected by centrifugation (14,000xg, 10 minutes at 4C) and quantified (Qubit 4 Fluorometer, Agilent TapeStation). Native H3K4me3 ChIP-seq was performed in 500ul SDSless RIPA [10 mM Tris pH 8.0 ...
-
bioRxiv - Biochemistry 2021Quote: ... The digestion and desalting (total time 3 min) were driven by 0.4% formic acid (FA) in water pumped by 1260 Infinity II Quaternary pump (Agilent Technologies, Waldbronn, Germany) at a flow rate of 100 μL·min−1 ...
-
bioRxiv - Cell Biology 2024Quote: ... Step 3 was endogenous peroxidase blocking (Dako REAL Peroxidase-blocking reagent ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent ...
-
bioRxiv - Cell Biology 2020Quote: ... Germany) followed by overnight incubation at 4 °C with specific primary antibodies: polyclonal rabbit anti-human AAT (1:800) (DAKO A/S, Glostrup, Denmark), mouse monoclonal anti-AAT polymer antibody (clone 2C1 ...
-
bioRxiv - Neuroscience 2020Quote: ... and incubated overnight at 4°C in primary antibody (2% NGS in TBST) with either rabbit anti-GFAP (1:2000, Agilent Cat# Z0334, RRID: AB_10013382), rabbit anti-synaptophysin (IgG ...
-
bioRxiv - Cancer Biology 2024Quote: ... The slides were incubated overnight at 4 °C with anti-CA125 mouse monoclonal antibody (Clone M11, Agilent Dako, Santa Clara, CA, USA 1:1000). Dako’s Envision diaminobenzidine (DAB ...
-
bioRxiv - Cancer Biology 2024Quote: ... The slides were incubated overnight at 4 °C with anti-CA125 mouse monoclonal antibody (Clone M11, Agilent Dako, Santa Clara, CA, USA 1:1000). Dako’s Envision diaminobenzidine (DAB ...
-
Machine learning and data-driven inverse modeling of metabolomics unveil key process of active agingbioRxiv - Systems Biology 2024Quote: ... Gas separation was performed on the HP-5MS column (30 m 3 0.25 mm 3 0.25 mm, Agilent Technologies).
-
bioRxiv - Synthetic Biology 2021Quote: ... The column was Poroshell 120 EC-C18 (150 mm × 4.6 mm, 100Å, particle size 4 μm; Agilent Technologies). The injection volume was 10 μL ...
-
bioRxiv - Cancer Biology 2021Quote: ... or 1 μM (OMM2.3) carbonyl cyanide 4-(trifluoromethoxy)-phenylhydrazone (FCCP) and 0.5 μM of a rotenone antimycin A mix (Agilent). Following the assay ...
-
bioRxiv - Developmental Biology 2021Quote: ... then at 4°C overnight with primary antibodies diluted in Dako REAL Antibody Diluent (Agilent, Santa Clara, CA). We used the following primary antibodies ...
-
bioRxiv - Synthetic Biology 2023Quote: ... with an eliminated kanamycin-resistance cassette (Supplementary Fig. 4) and XL10-Gold (Agilent Technology, Inc., Santa Clara, CA), were used for cloning and library construction ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were seeded at 4 x 104 cells per well in XFe24 cell culture microplates (Agilent, 102340-100) in 10 ml of DMEM [high glucose DMEM with pyruvate (Gibco ...
-
bioRxiv - Cancer Biology 2022Quote: 2×104 – 4×104 cells per well were plated onto a Seahorse XFe96 FluxPak plate (Agilent, 102416-100). On the day of the assay ...
-
bioRxiv - Cancer Biology 2022Quote: Cells were seeded at 4×104 cells per well in Seahorse XF24 tissue culture plates (Seahorse Bioscience Europe). The sensor cartridge was placed into the calibration buffer medium supplied by Seahorse Biosciences to hydrate overnight ...
-
Lactylation-driven FTO-mediated m6A modification of CDK2 aggravates diabetic microvascular anomaliesbioRxiv - Cell Biology 2023Quote: ... The m6A level was then determined using a Synergy 4 automatic microplate reader (Agilent BioTek; Winooski, VT, USA) at 450 nm.
-
bioRxiv - Genomics 2023Quote: ... which brought the total number of DNA probes to 174,550 spots for a 4×180k microarray (Agilent Technologies). Additional spots on the array were set aside for control grid alignment ...
-
bioRxiv - Neuroscience 2024Quote: ... and then subjected to overnight incubation at 4°C with the primary antibodies: rabbit anti-GFAP (Z0334, DAKO), mouse anti-Rhodopsin (AB5417 ...
-
bioRxiv - Cancer Biology 2024Quote: ... the AFC (7-amino-4-trifluoromethyl coumarin) fluorescent signals were measured on a Cytation 5 instrument (Agilent Technologies) using the fluorometer function (410-20nm excitation bandwidth ...
-
bioRxiv - Genetics 2024Quote: ... for 30 min then incubated overnight at 4 °C in primary antibody diluted in Dako antibody diluent (Agilent) at concentrations shown in Table 2 ...
-
bioRxiv - Biophysics 2022Quote: ... The samples were then further diluted in ultrapure water to a final 3% nitric acid concentration and analyzed by triple quadrupole inductively coupled plasma-mass spectrometry (Agilent 8800 ICP-QQQ). Copper concentrations were determined by using standard curves ...
-
bioRxiv - Cancer Biology 2022Quote: ... explants treated with BrdU substrate for 24 hours prior to fixation as described in Section 6.3.1) (DAKO, Cat. M0744; 1:50 overnight at 4 °C), cytokeratin (DAKO ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5 ...
-
bioRxiv - Cancer Biology 2021Quote: ... before staining at a previously optimised dilution (BCL-xL 1:500; cleaved Caspase 3 1:500; MCL-1 1:200) and visualised with Liquid DAB (Agilent, UK). Ki67 (Agilent #M7240 ...
-
bioRxiv - Physiology 2020Quote: ... Acetone was measured using an agilent DB-35MS column (30 m 3 0.25mm i.d. 3 0.25 mm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Developmental Biology 2024Quote: ... By site-directed mutagenesis the V5 tag of the pMT-Bip V5-His A vector was replaced by a Myc sequence (EQKLISEEDL) using the primers: Fw: 5’– AGCGAAGAGGATCTGACGCGTACCGGTCATCAT–3 and 5’– AATCAGTTTCTGTTCGAATTCCACCACACTGGACTAGTAGGTACC–3’ and the PFU ultra (Agilent). The cDNA for Drospondin without the signal peptide sequence and the stop codon was amplified using the clone GH02025 from Drosophila Genome Resource Center (DGRC) ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fragment 3 was pBluescript KS (-) (Stratagene, California USA), which was digested using Xba ...
-
bioRxiv - Pathology 2021Quote: ... 3′-diaminobenzidine tetra-hydrochloride chromogen (DAB, K3468, Dako) was added to all sections and the reaction was stopped with distilled water ...
-
bioRxiv - Microbiology 2023Quote: ... then labeled using Cyanin-3 CTP (Agilent Technologies) and hybridized on chips containing 45000 probes (4×44K Whole Human Genome) ...
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm 2.7 μm HPLC column (Agilent) with a Poroshell 120 PFP ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2024Quote: ... anti-Cluster of Differentiation 3 (CD3; Agilent Dako), anti-Paired box protein-5 (Pax-5 ...
-
bioRxiv - Microbiology 2024Quote: ... anti-Cluster of Differentiation 3 (CD3; Agilent Dako), anti-Paired box protein-5 (Pax-5 ...
-
bioRxiv - Cell Biology 2020Quote: ... the membrane was incubated with horseradish peroxidase-conjugated streptavidin (P0397; Dako; 1:3000, 3% BSA) at 4°C overnight ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µL was mixed with 3 µL D1000 sample buffer (Agilent Technologies, cat # 5190-6502) and run on Agilent 4200 TapeStation platform with D1000 screenTape (Agilent Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... were diluted with ultra-pure water to reduce the acid concentration below 3% and loaded into the ICP-MS-MS (triple quad Agilent 8800x ICP-MS-MS). The instrumental conditions were optimized to remove interferences by using a collision/reaction cell ...
-
bioRxiv - Cancer Biology 2021Quote: ... and the cells were washed twice with 200 μL/well of assay medium (XF DMEM Base Medium, pH 7.4 containing 25 mM Glucose and 4 mM Glutamine; Agilent). After washing ...