Labshake search
Citations for Agilent :
3751 - 3800 of 9267 citations for Human Fragile X Mental Retardation 1 Neighbor Protein FMR1NB ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... and integrity (Agilent RNA 6000 Pico kit; Agilent Technologies, Santa Clara, CA, USA). The average RNA integrity number (RIN ...
-
bioRxiv - Microbiology 2024Quote: ... and H1N1pdm09 were generated using the QuikChange II site-directed mutagenesis kit (Agilent). The PR8 pHW-PA(ΔX ...
-
bioRxiv - Biochemistry 2024Quote: ... mutagenesis was performed using the QuickChange® Lightning Site-Directed Mutagenesis Kit (Agilent) using the forward primer 5’ CAAACAGATTGTGAGTATAACTACTGGGGCCAG 3’ and the reverse primer 5’ AGTTATACTCACAATCTGTTTGTGGACTCCAACCCG 3’ ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA was synthetized using the Affinity Script Multiple Temperature cDNA Synthesis kit (Agilent), following manufacturer’s instructions with oligo-dT primers ...
-
bioRxiv - Neuroscience 2024Quote: ... and High Sensitivity NGS fragment analysis kit on the Fragment Analyzer (Agilent Technologies). The amount of cDNA was standardized across samples and the libraries were sequenced on Illumina NextSeq500 sequencing machine with 75-bp single-end reads ...
-
bioRxiv - Developmental Biology 2024Quote: ... following the instructions of the manufacturer (Agilent RNA 6000 Pico Kit 5067–1513). Amplification of the extracted RNA (700 pg ...
-
bioRxiv - Molecular Biology 2024Quote: Site-directed mutagenesis was performed using QuikChange II Site-Directed Mutagenesis Kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... Total RNA was quantified on an Agilent BioAnalyzer via the Pico kit (Agilent). SMART-Seq HT Kit (Takara ...
-
bioRxiv - Physiology 2024Quote: ... To analyze the deuterium enrichment of alanine in the protein fractions we used Gas Chromatography-Mass Spectroscopy (7890A GC-Agilent 5975C MS, Agilent, Santa Clara, CA)52,53.
-
bioRxiv - Cell Biology 2020Quote: ... The cells were incubated with anti-tubulin (Thermo PA1-41331; dilution 1:250) and K9JA (Dako A0024; dilution 1:500) antibody ...
-
bioRxiv - Cell Biology 2020Quote: ... then probed for 1 hr at room temperature with HRP-conjugated goat anti-mouse IgG secondary antibodies 1:500 in PBS (Dako, Agilent Technologies ...
-
bioRxiv - Cell Biology 2019Quote: ... and incubated overnight at 4°C with primary antibodies (rabbit anti-TMEM98, Proteintech, 1:1000; rabbit anti-FLAG polyclonal, Sigma, 1:2000; mouse anti-FLAG monoclonal M2, Stratagene 1:2000 ...
-
bioRxiv - Immunology 2019Quote: ... incubated overnight at 4 °C with polyclonal guinea pig anti-insulin antibody (1:100 in 1% BSA in DPBS, DAKO) followed by 1 h room temperature incubation either with Alexa Fluor® 488 AffiniPure donkey anti-guinea pig or with DyLight™ 594 AffiniPure donkey anti-guinea pig secondary antibody (1:100 in 1% BSA in DPBS ...
-
bioRxiv - Neuroscience 2020Quote: ... Briefly, Iba1 (Wako, 019-19741, 1:2,000) was used to visualize microglia/macrophages and anti-GFAP (Dako, Z0334, 1:15,000) was used to visualize astrocytes ...
-
bioRxiv - Cancer Biology 2020Quote: ... trifluoroacetamide containing 1% trimethylchlorosilane (Pierce, 20 μl, 1 hour, 37 °C) and analysed by GC-MS using a VF5 capillary column (Agilent, 30 m ...
-
bioRxiv - Microbiology 2020Quote: ... The blocked membrane was then probed with anti-HA (1:1000 dilution, CellSignalling) and rabbit anti-mouse P260 IgG conjugated with HRP (1:1000 dilution, DAKO). The antibody-stained membrane was then soaked with SuperSignal West Pico PLUS substrate (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... to prevent non-specific binding was followed by a 1-hour incubation in primary antibody (pERK; 1:800) in Antibody Diluent (S0809, Agilent DAKO). Following removal of excess primary antibody with wash buffer ...
-
bioRxiv - Microbiology 2021Quote: ... Nucleus staining was performed with DAPI 1 µg/mL for 1 min and coverslips were mounted on slides with fluorescent mounting medium (Dako). Cells were observed under a SP8 confocal laser-scanning microscope equipped with an HCP PL APO 100x/1.44 Oil CORR CS immersion objective (Leica) ...
-
bioRxiv - Neuroscience 2020Quote: ... Immunohistochemistry with polyclonal antibody 1175 (1:1,000) directed against α-synuclein phosphorylated at Ser129 or anti-ubiquitin (DAKO, 1:10,000) were performed as described previously (Masuda-Suzukake et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... diluted 1:100 or CD3 antibodies (Spring biosciences, Clone SP7, ref. M3070) diluted 1:200 in Antibody diluent solution (DakoCytomation). After several washes in PBS ...
-
bioRxiv - Biophysics 2019Quote: ... anti-surfactant C protein antibody to target membrane antigen secreted from airway type 2 epithelial cells in alveoli or ii) anti-thyroid transcription factor-1 (TTF-1) antibody (Dako Agilent Products ...
-
bioRxiv - Biophysics 2019Quote: ... anti-surfactant C protein antibody to target membrane antigen secreted from airway type 2 epithelial cells in alveoli or ii) anti-thyroid transcription factor-1 (TTF-1) antibody (Dako Agilent Products ...
-
bioRxiv - Molecular Biology 2020Quote: ... Goat polyclonal anti-mouse (p0447, bach number 20051789. 1/3000) and anti-rabbit (p0448, batch number 20017525. 1/5000) antibodies were purchased from Dako.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Polyclonal goat anti-rabbit (#P0448, dilution 1:5000) and polyclonal goat anti-mouse (#P0447, dilution 1:5000) secondary antibodies were obtained from Dako products (CA ...
-
bioRxiv - Cancer Biology 2020Quote: ... sections were blocked in DAB substrate-chromogen solution containing 1 ml substrate buffer and 1 drop of DAB chromogen (DAKO) for 10 minutes followed by rising with dH2O for 5 minutes ...
-
bioRxiv - Biophysics 2019Quote: ... construct by deleting 14aa from near the C-terminus of PRC1 isoform 1 (aa:1-620) using Quikchange mutagenesis (Agilent). The PRC1 isoform 2 gene was then in a pET-DUET plasmid containing an N-terminal histidine tag followed by a Tobacco Etch Virus (TEV ...
-
bioRxiv - Cell Biology 2020Quote: ... then probed for 1 hr at room temperature with HRP-conjugated goat anti-mouse IgG secondary antibodies 1:500 in PBS (Dako, Agilent Technologies ...
-
bioRxiv - Neuroscience 2022Quote: ... brain sections were blocked with 5% normal donkey serum for 1 h at room temperature and incubated with primary antibodies (rabbit anti-GFAP 1:200, Dako; goat anti-Iba1 ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-Pu.1 (1:200; 2258, Cell Signalling), hamster anti-CD3 (1:500; MCA2690, AbD Serotec) or rabbit anti-GFAP (1:2400, Z0334, Dako) diluted in the blocking solution overnight at 4°C plus one additional hour at room temperature (RT) ...
-
bioRxiv - Physiology 2024Quote: ... tissues were incubated with primary antibody over night at 4°C (guinea pig anti-insulin at 1:4, diluted in 1% goat serum/PBS, Agilent). This was followed by 1-hour incubation with fluorophore-conjugated secondary antibodies (Cy3-anti-guinea pig ...
-
bioRxiv - Immunology 2024Quote: ... The membrane was washed three times in block buffer followed by a 1 h incubation with anti-goat/-rabbit HRP-conjugated secondary antibodies (1:5000, Agilent Dako) at RT ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed three times for 20 min in TBS-T before incubation with horseradish peroxidase (HRP)-labeled secondary antibody in TBS-T at RT for 1 hour: Goat anti-Rabbit HRP (1:10,000, Agilent P0448), Rabbit anti-Goat HRP (1:10,000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 0.1% w/v Tween-20 for 5 min and incubated with the following secondary antibodies for 1 hour at room temperature: swine anti-rabbit (1:200, catalog no. P0339, Dako) or anti-mouse horseradish peroxidase (HRP)-conjugated immunoglobulins (1:200 ...
-
bioRxiv - Genomics 2023Quote: ... CD20, Ventana Roche L26, prediluted; CD3, Leica LN10, 1:500; CD68, DAKO A/S PG-M1, 1:50; CD138, DAKO A/S ...
-
bioRxiv - Biochemistry 2023Quote: ... shRNAs against mouse ACOT12 (#5, #6 and #7) and mouse ACOT8 (#1 and #2) were also constructed in pAdEasy-1 (Stratagene) for adenovirus packaging based on The AdEasyTM Technology (He et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... which was amplified using Herculase II Fusion DNA polymerase in 100-µl reaction mixtures (1× Herculase II reaction buffer, 1 mM dNTPs, 200 pM Agilent library ...
-
bioRxiv - Cancer Biology 2023Quote: ... The organic samples were resuspended in 200 µL of 2:1:1 isopropyl alcohol:acetonitrile:water and transferred to amber glass mass spectrometry vials (Agilent 5182-0716) containing a glass insert ...
-
bioRxiv - Cancer Biology 2023Quote: ... The organic samples were resuspended in 35x the packed cell volume using 2:1:1 isopropyl alcohol:acetonitrile:water and transferred to amber glass mass spectrometry vials (Agilent, 5182-0716) containing a glass insert ...
-
bioRxiv - Neuroscience 2023Quote: ... free-floating brain slices were incubated in a solution of anti-Iba1 antibody (1:2000; Fuji film-Wako) or anti-GFAP antibody (1:10,000; Agilent-Dako) at 4°C overnight ...
-
bioRxiv - Cell Biology 2024Quote: ... goat horseradish peroxidase (HRP) anti-mouse IgG (#P0447; 1:1000) and anti-rabbit IgG (#P0448; 1:1000) were from Dako.
-
bioRxiv - Pathology 2024Quote: ... the above IHC protocol was modified such that the anti-SARS-CoV-2 S primary antibody was at 1:1000 dilution (1 µg/mL) in background-reducing antibody diluent (Dako, S302283-2 ...
-
bioRxiv - Biochemistry 2020Quote: ... and secondary rabbit (Dako, P0448, 1/1000 dilution), mouse anti-IgG-HRP (Dako ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-PCNA antibody (1:1000, PC10, Dako). Following secondary antibodies (all 1:500 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 1 µl of PfuTurbo DNA polymerase (Agilent) for amplification in a final volume of 50 µl ...
-
bioRxiv - Developmental Biology 2021Quote: ... Primary antibodies used were: Insulin (DAKO, 1:400), C-peptide (Abcam ...
-
bioRxiv - Microbiology 2021Quote: ... 1:1500 goat anti-mouse IgG-HRP (Dako). Coomassie staining of recombinant protein after gel electrophoresis was performed by addition of 0.1% Brilliant blue R-250 for 20 mins (Fisher) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 1 μM Rotenone/Antimycin A (Agilent, 103015-100) were added at indicated timepoints ...
-
bioRxiv - Neuroscience 2021Quote: ... GFAP (1:1000, Agilent Dako, Glostrup, Denmark, Z0334), Neuropeptide Y (1:500 ...
-
bioRxiv - Neuroscience 2021Quote: ... GFAP (1:1000, Agilent Dako, Glostrup, Denmark, Z0334), Neuropeptide Y (1:500 ...
-
bioRxiv - Neuroscience 2021Quote: ... Anti-GFAP antibody (1:300, Dako Z0334, USA), and Anti-Aba1 antibody (1:200 ...