Labshake search
Citations for Agilent :
3701 - 3750 of 9267 citations for Human Fragile X Mental Retardation 1 Neighbor Protein FMR1NB ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... or a Bioanalyzer using the High Sensitivity DNA kit (Agilent, cat. #5067-4626).
-
bioRxiv - Microbiology 2023Quote: For assays run with the Seahorse XF Cell Mito Stress Test Kit (Agilent), cells were washed once with assay medium before incubating in assay medium in a non-CO2 ...
-
bioRxiv - Bioengineering 2023Quote: Amplicons were concentrated by QIAquick gel extraction kit and estimated by Bioanalyzer (Agilent). The NGS sequence library was created by ligating illumina universal sequence adapter with the barcode for MISeq paired 300 bp reads (Illumina) ...
-
bioRxiv - Biochemistry 2023Quote: ... Amplified DNA was subcloned with StrataClone Blunt PCR cloning kit (Agilent Technologies, 240207) and sequenced with M13 Forward ...
-
bioRxiv - Neuroscience 2023Quote: ... and their quality was assessed using the Bioanalyzer High-Sensitivity DNA kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Integrity of RNA samples was evaluated using the RNA 6000 Nano Kit (Agilent) and the Agilent 2100 Bioanalyzer ...
-
bioRxiv - Immunology 2023Quote: ... and was analyzed for quality using the RNA 6000 Pico Kit (Agilent Technologies). Poly(A)-enriched next-generation sequencing library construction was performed using the KAPA mRNA Hyper Prep Kit (KAPA Biosystems ...
-
bioRxiv - Microbiology 2023Quote: ... The divIVAR94N allele was generated using the QuikChange site-directed mutagenesis kit (Agilent). For B ...
-
bioRxiv - Immunology 2023Quote: ... and quality was checked using 2100 Bioanalyzer with High Sensitivity DNA kit (Agilent). Libraries were sequenced with the NovaSeq 6000 platform (S1 Cartridge ...
-
bioRxiv - Immunology 2023Quote: ... Library quality was assessed using a 2100 Bioanalyzer High Sensitivity DNA kit (Agilent).
-
bioRxiv - Cell Biology 2023Quote: The TeloFISH was carried out using the Telomere PNA FISH Kit/Cy3 (Dako), following the manufacturer instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... YAP S61A mutant was generated utilizing a QuikChange site-directed mutagenesis kit (Agilent) and confirmed by sequencing (Eurofins Genomics).
-
bioRxiv - Cell Biology 2023Quote: ... Appropriate mutagenesis was done using QuikChange Lightning Multi Site-Directed mutagenesis kit (Agilent). Final product plasmids were confirmed by Sanger sequencing ...
-
bioRxiv - Immunology 2023Quote: ... Glycolytic parameters were measured using the glycolysis stress test kit (Agilent; 103020-100), measurement of ECAR (extracellular acidification rate ...
-
The tetrapeptide sequence of IL-1β regulates its recruitment and activation by inflammatory caspasesbioRxiv - Immunology 2023Quote: ... Point mutations were generated using the QuikChange II site-directed mutagenesis kit (Agilent) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... C328H and C328D were generated by site directed mutagenesis using kits from Agilent or Nzytech ...
-
bioRxiv - Cancer Biology 2022Quote: ... and final sequencing libraries were performed using Bioanalyzer High Sensitivity DNA Kit (Agilent). The sequencing libraries for scRNAseq and scTCRseq were normalized to 4nM concentration and pooled using a volume ratio of 4:1 ...
-
bioRxiv - Genomics 2023Quote: ... and assessed for fragment size using the BioAnalyzer HS DNA Assay kit (Agilent). Following library pooling in equimolar concentrations ...
-
bioRxiv - Genomics 2023Quote: ... Individual library Qc was performed using the BioAnalyzer HS DNA Assay kit (Agilent).
-
bioRxiv - Cell Biology 2023Quote: ... Mitochondrial respiration was measured using Seahorse XF Cell Mito Stress Test kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... Using the DNA high-sensitivity kit in the 2100 Bioanalyzer (Agilent Technologies, USA), the library quality and quantity of the appropriate fragment length (250 bp ...
-
bioRxiv - Molecular Biology 2023Quote: RNA was extracted from NSC34 cells using the Absolutely RNA Microprep kit (Agilent). The rRNA levels were measured by real-time quantitative PCR after reverse transcription of RNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... and verified using the Bioanalyzer DNA High Sensitivity Assay Kit (Agilent, 5067-4626). Validated samples were sequenced using the NextSeq1000/2000 P2 Reagents (100 Cycles ...
-
bioRxiv - Plant Biology 2023Quote: ... and size distribution was measured using the Agilent High Sensitivity DNA Kit (Agilent). Libraries were pooled together and performed paired-end sequencing on an Illumina Hi-Seq 2000.
-
bioRxiv - Neuroscience 2023Quote: ... Mutagenesis was performed using the QuikChange II Site-directed Mutagenesis kit (Agilent Technologies).
-
bioRxiv - Cancer Biology 2023Quote: ... RNA integrity was analyzed using NanoChip (Agilent RNA 6000 Nano kit, 5067-1511). A total of 2 µg RNA was purified by poly(A ...
-
bioRxiv - Physiology 2023Quote: ... A high sensitivity small DNA Fragment Analysis kit (Agilent Technologies, DNF-477-0500) was used to assess the quality of each library pool.
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were constructed using the Sure Select All Exon v6 library kit (Agilent) following the XT library preparation workflow ...
-
bioRxiv - Plant Biology 2023Quote: ... and size distribution was determined using the Agilent High Sensitivity DNA Kit (Agilent). Libraries were pooled together for paired-end sequencing on an Illumina Hi-Seq 3000 ...
-
bioRxiv - Cell Biology 2023Quote: ... Purified libraries were run on Agilent High Sensitivity DNA Kit chip (Agilent Technologies) to verify the expected size distribution ...
-
bioRxiv - Neuroscience 2023Quote: ... Library quality was assessed by high sensitivity DNA analysis kit (Agilent, 5067-4626) on the 2100 Bioanalyzer instrument ...
-
bioRxiv - Developmental Biology 2023Quote: ... RNA integrity was validated using the Agilent 6000 Pico Kit (Agilent, #5067-1513). For each sample ...
-
bioRxiv - Genetics 2023Quote: Genotyping was performed using the Herculase II Fusion DNA Polymerases kit (Agilent, #600677) following manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... Site-directed mutagenesis was performed by QuikChange Site-directed Mutagenesis Kit (Agilent 200523). Multi site-directed mutagenesis was performed by QuikChange Multi site-directed Mutagenesis Kit (Agilent 200513) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Mutagenesis was performed using the QuickChange II XL Site-Directed Mutagenesis Kit (Agilent) following manufacturer’s guidelines ...
-
bioRxiv - Neuroscience 2023Quote: ... and integrity using Bioanalyzer 2100 and RNA Nano 6000 Kit (Agilent Technologies, USA). Sequencing libraries were generated using NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina® (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... Retrovirus production was performed according to the MBS Mammalian Transfection Kit (Agilent Technologies) and virus was harvested after 2 days from confluent cells ...
-
bioRxiv - Cell Biology 2023Quote: ... Whole exome sequencing (WES) was performed using the Mouse All Exon kit (Agilent) for target capture followed by next-generation sequencing by Psomagen ...
-
bioRxiv - Molecular Biology 2023Quote: The Seahorse XF Cell Mito Stress Test Kit (Cat. No. 103015-100, Agilent Technologies ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... A Plant RNA Pico kit was used on a 2100 Bioanalyzer (Agilent Technologies) to confirm the quality of the RNA isolates ...
-
bioRxiv - Genomics 2024Quote: ... and Fragment Analyser using the DNA HS 50kb large fragment kit (Agilent Tech.) Before PacBio HiFi library preparation ...
-
bioRxiv - Cancer Biology 2024Quote: ... using the HS-D5000 and HS-D1000 High Sensitivity DNA kits (Agilent Technologies), respectively ...
-
bioRxiv - Biophysics 2024Quote: ... site-directed mutagenesis was performed using Quick Change II XL kit (Agilent Technologies) using the primers listed in Table S3 ...
-
bioRxiv - Plant Biology 2024Quote: ... or Femto Pulse Genomic DNA 165 kb Kit (Agilent cat# FP-1002-0275). For samples sourced from “OCBD” (Supplemental Table 1 ...
-
bioRxiv - Neuroscience 2024Quote: ... and integrity (Agilent RNA 6000 Pico kit; Agilent Technologies, Santa Clara, CA, USA). The average RNA integrity number (RIN ...
-
bioRxiv - Genomics 2024Quote: ... DNA quality was assessed with the TapeStation genomic DNA kit (Agilent, #5067-5365). Samples too diluted to be compatible with the kit were first concentrated using AMPure Beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2024Quote: ... and H1N1pdm09 were generated using the QuikChange II site-directed mutagenesis kit (Agilent). The PR8 pHW-PA(ΔX ...
-
bioRxiv - Molecular Biology 2024Quote: Isolated RNA was examined on a Bioanalyzer with the RNA Nano kit (Agilent). RNA-Seq library preparation was carried out with 1 µg of RNA from all samples that passed an RNA Integrity Number (RIN ...
-
bioRxiv - Biochemistry 2024Quote: ... mutagenesis was performed using the QuickChange® Lightning Site-Directed Mutagenesis Kit (Agilent) using the forward primer 5’ CAAACAGATTGTGAGTATAACTACTGGGGCCAG 3’ and the reverse primer 5’ AGTTATACTCACAATCTGTTTGTGGACTCCAACCCG 3’ ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA was synthetized using the Affinity Script Multiple Temperature cDNA Synthesis kit (Agilent), following manufacturer’s instructions with oligo-dT primers ...