Labshake search
Citations for Agilent :
3501 - 3550 of 5930 citations for Rat N acylethanolamine hydrolyzing acid amidase NAAA ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... and their quality and concentration were assessed using a 2100 Bioanalyzer with the High Sensitivity DNA Kit (Agilent) and a Qubit Fluorometer with the Qubit dsDNA HS Assay Kit (Life Technologies) ...
-
bioRxiv - Microbiology 2019Quote: ... Library size distribution was evaluated using the High sensitivity dsDNA kit on a 2100 Bioanalyzer (Agilent, 5067-4626) and qPCR based library quantification was performed using the KAPA Library Quantification kit for Illumina platforms (KAPA Biosystems ...
-
bioRxiv - Plant Biology 2019Quote: ... RNA concentration and quality was analysed with Agilent RNA 6000 Nano Kit at a Bioanalyzer 2100 (Agilent Technologies).
-
bioRxiv - Biophysics 2019Quote: Point mutations were introduced into hamster SUR1 cDNA in pECE using the QuikChange site-directed mutagenesis kit (Stratagene). Mutations were confirmed by DNA sequencing ...
-
bioRxiv - Microbiology 2019Quote: ... and Cy3-labeled cRNAs were synthesized using the Low Input Quick Amp Labeling kit (one-color, Agilent Technologies). Labeled probes were purified with RNeasy kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The quality of the total RNA was analysed using an Agilent Bioanalyzer RNA 6000 Pico kit (Agilent Technnology). Poly(A ...
-
bioRxiv - Cancer Biology 2019Quote: ... Variant calls were made with GATK UnifiedGenotyper using the mm9 reference sequence in regions targeted by the Agilent capture kit (version G7550_20110119_mm9 from Agilent). Calls with at least 14X read coverage and dual strand support were retained and further filtered using GATK VariantFiltration (arguments - clusterWindowSize 10 - cluster 3) ...
-
bioRxiv - Genetics 2019Quote: The Cas9 high fidelity variants were generated by “QuikChange Multi Site-Directed Mutagenesis Kit” (Agilent Technologies, CA, USA) with primers listed in supplemental table 1 ...
-
bioRxiv - Biophysics 2019Quote: ... HIV-1 MAG2A-EGFP was made using the QuikChange XL Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA). HIV-1 MAG2A-ΔHBR-EGFP was generated from HIV-1 MAG2A-EGFP by deleting amino acids 18-32 using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs ...
-
bioRxiv - Cancer Biology 2019Quote: ... and were subjected to quality check with a Bioanalyzer 2100 using an RNA 6000 nano kit (Agilent Technologies). RNA sequencing was performed using Illumina HiSeq 4000 ® (for lung cancer tissue RNAs ...
-
bioRxiv - Neuroscience 2019Quote: ... RNA was eluted by adding 100 µl Lysis Buffer and purified using the Absolutely RNA Nanoprep Kit (Agilent).
-
bioRxiv - Genetics 2021Quote: ... and quality checked on Agilent Bioanalyzer using the Agilent RNA 6000 Nano kit (Agilent, Santa Clara, CA, USA). Single end ...
-
bioRxiv - Genetics 2021Quote: Mutagenesis of the sequence encoding Sir3464-728 using the GeneMorph II EZClone Domain Mutagenesis Kit (Agilent, 200552-5) was performed by PCR on 9,5 µg of pACT2-SIR3464-728 with 20 cycles of amplification to allow low mutation rate ...
-
bioRxiv - Genetics 2020Quote: ... The total RNA was amplified using the Sure Select Stranded RNA-Seq kit (Agilent Technologies; Santa Clara, CA) using standard protocols ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Library size distributions were assessed using the Agilent Technology 2100 Bioanalyzer and the High Sensitivity DNA kit (Agilent Technologies ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and the quality and quantity of that pool was assessed via electrophoresis (High-Sensitivity DNA Kit and Agilent Bioanalyzer ...
-
bioRxiv - Developmental Biology 2021Quote: ... product size distribution and quantity were assessed on a Bioanalyzer using a High Sensitivity DNA Kit (Agilent Technologies). A total of 140 pg of the amplified cDNA was fragmented using Nextera XT (Illumina ...
-
bioRxiv - Immunology 2021Quote: ... RNA quality was checked using the Agilent RNA 6000 Nano Kit on the Agilent 2100 Bioanalyzer (Agilent Technologies). Gene expression was analyzed using the NanoString’s nCounter digital barcode technology ...
-
bioRxiv - Genomics 2021Quote: ... RNA integrity and purity were assessed using an Agilent 2100 Bioanalyser and RNA 6000 Pico Kit (Agilent, USA) and a Tapestation (Agilent) ...
-
bioRxiv - Neuroscience 2020Quote: ... The V990M and P1090Q mutants were generated using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies). For the GPCR regulation of these mutants ...
-
bioRxiv - Systems Biology 2020Quote: ... The resulting dscDNA was validated by determining size (∼1kb) using a BioAnalyzer DNA High Sensitivity kit (Agilent Technologies). Then ...
-
bioRxiv - Microbiology 2021Quote: ... we generated a pT7-D6/2-NSP1-null via the QuikChange II site-directed mutagenesis kit (Agilent Technology) based on pT7-D6/2-NSP1 (22) ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA quality assessment was performed using a Bioanalyzer 2100 with RNA 6000 Pico Kit (Agilent Technologies, 5067-1513). cRNA quality assessment was done using a Fragment Analyzer-96 with the Standard Sensitivity RNA Analysis Kit (15-nt ...
-
bioRxiv - Bioengineering 2020Quote: ... anti-SOX17, and anti-SOX9 (MerckMillipore, AB5535, 1:300) antibodies and visualization with EnVision FLEX Mini kit (DAKO).
-
bioRxiv - Biochemistry 2020Quote: ... GPx7 and GPx8 Cys-Ala mutants were constructed by using the QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies).
-
bioRxiv - Biochemistry 2020Quote: All mutations in C100 FLAG were introduced by site-directed mutagenesis (QuickChange Lightning Site Directed Mutagenesis kit, Agilent) in pET 22b vector ...
-
bioRxiv - Neuroscience 2021Quote: ... Missense mutations were introduced by site-directed mutagenesis using the Quik-Change II site-directed mutagenesis kit (Agilent) and mutagenic oligonucleotides obtained from Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2020Quote: ... using the qualitative DNA Kit dsDNA Reagent 35-5000bp (Cat No. DNF-915, Agilent Technologies, Santa Clara, USA).
-
bioRxiv - Biochemistry 2020Quote: ... Site-directed mutagenesis in the PH-COOH background was performed using the QuikChange Site-Directed Mutagenesis Kit (Stratagene) or the Q5 Site-Directed Mutagenesis Kit (NEB) ...
-
bioRxiv - Microbiology 2020Quote: ... S27 isolate-based plasmid via site-directed mutagenesis using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies). The following mutations were introduced ...
-
bioRxiv - Plant Biology 2020Quote: The mutated variants were achieved by site-directed mutagenesis using the Multi-Directed Mutagenesis Kit (Agilent Technologies: California) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: Site-directed mutagenesis of PpKAI2L-H was performed using the QuickChange II XL Site Directed Mutagenesis kit (Stratagene), performed on pGEX-4T-3-PpKAI2L-H (see Supplementary Table 1 for primers) ...
-
bioRxiv - Microbiology 2020Quote: ... and library quality was checked using the High Sensitivity DNA LabChip Kit on the Bioanalyzer 2100 (Agilent Technologies). Sequencing clusters were generated using the MiSeq reagents kit v2 500 cycles (Illumina Inc. ...
-
bioRxiv - Microbiology 2020Quote: ... and library quality was checked using the High Sensitivity DNA LabChip Kit on the Bioanalyzer 2100 (Agilent Technologies). Sequencing clusters were generated using the MiSeq reagents kit v2 500 cycles (Illumina Inc. ...
-
bioRxiv - Microbiology 2020Quote: ... the adapter-ligated/RT primer mixture was used as template with the AffinityScript cDNA Synthesis Kit (Agilent, 600559) with the following reaction conditions ...
-
bioRxiv - Systems Biology 2020Quote: Five itpr residues in Drosophila itpr cDNA (Sinha & Hasan, 1999) were mutated using site directed mutagenesis kit (Agilent). The oligonucleotide CAGAGATCGGCAGCAATTGCTGCAGGAACAGTACATCC was used to change K530/R533 to Q while GTACCACGTCTTTCTGCAGACCACCGGACGCACCAG was used to change R272 to Q ...
-
bioRxiv - Microbiology 2020Quote: ... VSGsur mutants N130A and H122A were generated by site-directed mutagenesis using the QuikChange Lightening kit (Agilent Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... RNA was eluted by adding 100 μl Lysis Buffer and purified using the Absolutely RNA Nanoprep Kit (Agilent). cDNA was prepared with the Ovation RNA-seq V2 kit (Nugen ...
-
bioRxiv - Neuroscience 2020Quote: ... Cy3-labeled RNAs were hybridized to SurePrint G3 Mouse Gene Expression v2 8×60K Microarray Kit (Agilent Technologies) at 65 °C for 17h ...
-
bioRxiv - Biophysics 2021Quote: ... were pooled together and used to perform multisite mutagenesis using the QuikChange Multi site-directed mutagenesis kit (Agilent). Due to imperfect reaction efficiency ...
-
bioRxiv - Microbiology 2021Quote: ... The final library size and quality was evaluated using an Agilent High Sensitivity DNA Kit (Agilent Technologies, CA), and the fragments were found to be between 250 and 350 bp in size ...
-
bioRxiv - Microbiology 2021Quote: ... RNA quality was then assessed on an Agilent Bioanalyzer and the RNA 6000 Pico Kit (Agilent 5067-1513). PolyA RNA was isolated using the NEBNext Poly(A ...
-
Fruitless decommissions regulatory elements to implement cell-type-specific neuronal masculinizationbioRxiv - Neuroscience 2020Quote: The quality of prepared libraries was verified with a Bioanalyzer 2100 using a high sensitivity DNA kit (Agilent). Libraries were quantified using KAPA qPCR assay (KAPA Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were quality controlled using the Bioanalyzer High Sensitivity DNA Analysis Kit and the Agilent 2100 Bioanalyzer (Agilent). All samples were prepared and sequenced in technical replicate ...
-
bioRxiv - Microbiology 2021Quote: ... plasmid was reacted with primer pairs designed to introduce the desired mutations using Quikchange kit (Agilent, cat# 600670). After digestion with the restriction enzyme DpnI (NEB ...
-
bioRxiv - Plant Biology 2021Quote: ... All mutations listed in Supplemental Table 2 were introduced using the QuikChange Multi Site-Directed Mutagenesis Kit (Agilent) with appropriate mutagenic primers ...
-
bioRxiv - Plant Biology 2019Quote: ... was used as a template for cDNA synthesis with the Affinity Script QPCR cDNA Synthesis Kit (Agilent Technologies). RT-qPCR and data analysis were performed as described in [75] ...
-
bioRxiv - Microbiology 2021Quote: The NdeI site within the TbFUT1 sequence was eliminated using the QuickChange Lightning Site-Directed Mutagenesis Kit (Agilent) and primers P24/P25 ...
-
bioRxiv - Microbiology 2020Quote: ... and rRNA removal efficiency was then analyzed via the Agilent 2100 Bioanalyzer RNA 6000 Pico kit (Agilent Technologies). Library preparation for sequencing on the Illumina HiSeq platform was completed using the TruSeq stranded mRNA HT library preparation kit (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... RNA quality was measured using the Agilent 2100 Bioanalyzer RNA 6000 Nano kit (Agilent Technologies, Santa Clara, CA) and all RNA samples utilized for downstream RNAseq library preparation had an RNA integrity number (RIN ...