Labshake search
Citations for Agilent :
3301 - 3350 of 5930 citations for Rat N acylethanolamine hydrolyzing acid amidase NAAA ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... The libraries were analyzed for insert size distribution by using a 2100 BioAnalyzer High Sensitivity kit (Agilent). Then ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA concentration and integrity were determined using the Bioanalyzer High Sensitivity RNA Pico Kit (Agilent #5067-1513). Sequencing libraries were prepared using the NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina (New England Biolabs #E6420 ...
-
bioRxiv - Cell Biology 2022Quote: ... according to the manual of Seahorse XF Cell Mito Stress Test Kit (Agilent Technologies, cat#103015-100). Briefly ...
-
bioRxiv - Cancer Biology 2022Quote: ... The PCR product was then purified and transcribed using the RNA MAXX In Vitro Transcription Kit (Agilent) to produce the sgRNA ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by size distribution analysis in the Agilent 2100 Bioanalyzer using the High Sensitivity DNA Kit (Agilent). Libraries were sequenced in two runs of the Illumina NextSeq 500 instrument (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: ... followed by size distribution analysis in the Agilent 2100 Bioanalyzer using the High Sensitivity DNA Kit (Agilent). Libraries were sequenced in the Illumina NextSeq 500 instrument (Illumina ...
-
bioRxiv - Genomics 2022Quote: ... Library quality and size distribution was verified using a TapeStation D5000 HS kit (Agilent Technologies, 5067-5592). Samples were sequenced with a coverage of 50 M paired end reads (2 x 100 bp ...
-
bioRxiv - Genomics 2022Quote: ... The library size was estimated on Agilent Bioanalyzer 2100 using high sensitivity DNA kit (Agilent, United States). The normalized libraries were sequenced for 150 bp paired-end reads on Illumina NextSeq 500 platform using NextSeq 500/550 v2 and v2.5 sequencing reagent kits (Illumina Inc. ...
-
bioRxiv - Genomics 2022Quote: Cyanine-3 labeled cRNA was prepared using the One-Color Low input Quick Amp Labeling kit (Agilent). Dye incorporation and cRNA yield was measured with a NanoDrop ND1000 spectrophotometer (Thermofisher) ...
-
bioRxiv - Immunology 2022Quote: ... Myc-NEU3 mutants were generated using a QuikChange II Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA) with the DNA oligomers GGGCCCCTTAAACCACTTATTGAATCCACACTACC for mutant 1 and CAGTTCACTTAGACTGGAAGATGAATCTGGAACAC for mutant 2 ...
-
bioRxiv - Plant Biology 2022Quote: ... The mRNA-seq libraries were constructed by using SureSelect Strand Specific RNA Library Prep kit (Agilent Tech.) following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2022Quote: ... were generated using the QuikChange II XL site-directed mutagenesis kit according to the manufacturer’s instructions (Agilent). For expression of stabilized soluble S2P spike trimer proteins ...
-
bioRxiv - Microbiology 2022Quote: ... This was achieved by site-directed mutagenesis (QuikChange II Site Directed Mutagenesis Kit (Agilent, Santa Clara, CA)) using the primers EmaA-Pro-X-Gly-F and EmaA-Pro-X-Gly-R (Table 2 ...
-
bioRxiv - Microbiology 2022Quote: ... The mVSGG1954 mutant S321A was generated by site-directed mutagenesis using the QuikChange Lightening kit (Agilent Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... pooled and checked again using a Bioanalyzer (Agilent High Sensitivity DNA Kit, Agilent Technologies, Santa Clara, USA).
-
bioRxiv - Neuroscience 2022Quote: ... Site-directed mutagenesis was performed using a QuickChange Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... The library size was verified with a Bioanalyzer using an Agilent High Sensitivity DNA kit (Agilent Technologies). The concentration of each library was determined using the KAPA Library Quantification Kit (Roche ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Sequencing libraries were analyzed on an Agilent 2100 Bioanalyzer (High sensitivity DNA analysis kit, Agilent, 5067-4626) pooled in equimolar amounts (2.8 ng/μL ...
-
bioRxiv - Immunology 2022Quote: ... AIRR-seq libraries were then quality controlled using the 2100 Bioanalyzer High Sensitivity DNA Assay Kit (Agilent) and the Qubit 3.0 Fluorometer dsDNA High Sensitivity Assay Kit ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA quality was determined with Agilent’s 2100 Bioanalyzer using the High Sensitivity DNA Kit (5067-4626, Agilent) according to manufacturer’s instructions (representative images in Fig 1b).
-
bioRxiv - Microbiology 2022Quote: ... and an Agilent FEMTO Pulse System with a Genomic DNA 165 kb Kit (Agilent, FP-1002-0275), respectively ...
-
bioRxiv - Neuroscience 2022Quote: ... The cDNA for E111V variant was obtained by PCR using QuikChange II Site-Directed Mutagenesis kit (Agilent) as described in ref ...
-
bioRxiv - Synthetic Biology 2022Quote: ... spectrophotometry with a NanoDrop (Thermo) and on a 2100 Bioanalyser using an RNA 2000 Nano Kit (Agilent). RNA sequencing was performed by Novogene Co ...
-
bioRxiv - Physiology 2022Quote: ... and a Masson’s Trichrome Stain Kit to identify collagen fibers and fibrin (AR17311-2, Artisan, Dako, Agilent). Stainings were performed in a Dako Autostainer Plus (Dako ...
-
bioRxiv - Physiology 2022Quote: ... and a Masson’s Trichrome Stain Kit to identify collagen fibers and fibrin (AR17311-2, Artisan, Dako, Agilent). Stainings were performed in a Dako Autostainer Plus (Dako ...
-
bioRxiv - Molecular Biology 2022Quote: ... Detection of bound primary antibody was achieved using Dako EnVision + TM Peroxidase Rabbit Kit (DAKO, Glostrup, Denmark) or Dako EnVision + TM Peroxidase Mouse Kit (DAKO ...
-
bioRxiv - Molecular Biology 2022Quote: ... Mutant constructs (mut_GLA_FLAG/pCR3.1) were prepared by site-directed mutagenesis (Site-Directed Mutagenesis Kits, QuickChange II, Agilent) and selected by sequencing.
-
bioRxiv - Molecular Biology 2022Quote: ... Mutagenesis of CHRD and P1.40 was performed using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies). The integrity of the sequences of all constructs was confirmed by Sanger DNA sequencing.
-
bioRxiv - Microbiology 2022Quote: ... RNA integrity was assessed with a 2100 Bioanalyzer and the Prokaryote Total RNA 6000 Pico Kit (Agilent). All samples had an RNA Integrity Number (RIN ...
-
bioRxiv - Cell Biology 2022Quote: ... while oxygen consumption rate (OCR) assessed using a Cell Mito Stress Test kit (Agilent Technologies, 103015-100). ECAR and OCR were determined with an XF24 Extracellular Flux Analyzer (Seahorse Bioscience ...
-
bioRxiv - Immunology 2022Quote: ... Other variants were made by mutagenesis using QuickChange lightning Multi Site-Directed Mutagenesis Kit (cat # 210515, Agilent) or via synthesis and cloning (Genscript ...
-
bioRxiv - Cell Biology 2024Quote: ... and the size distribution was confirmed with High Sensitivity DNA Kit for Bioanalyzer (Agilent Technologies #5067-4626). Poly(A ...
-
bioRxiv - Cell Biology 2024Quote: ... PCR products were ligated into pSC-A vectors using a Blunt-end PCR cloning kit (Agilent #240207). Ligated plasmids were transformed into XL-1 blue competent cells ...
-
bioRxiv - Cancer Biology 2024Quote: The library size was determined using Agilent High Sensitivity DNA Kit on the Bioanalyzer instrument (Agilent Technologies). The sample was then pooled with other 10X libraries ...
-
bioRxiv - Microbiology 2023Quote: ... Site-directed mutagenesis on the pmPol I-LASV Sag plasmid was performed using QuikChange II kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Site-directed mutagenesis was performed using the QuikChange II XL site-directed Mutagenesis Kit (Agilent Technologies, 200521) as per the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... cDNA quality was determined using Agilent Fragment Analyzer 5200 and Genomic DNA (50kb) kit (Agilent DNF-467). See Supplementary Figures 50-61 for cDNA traces ...
-
bioRxiv - Cell Biology 2023Quote: ... and an Agilent Advanced Analytical Fragment Analyzer System using a Fragment Analyzer RNA Kit (Agilent, DNF-471), respectively ...
-
bioRxiv - Cancer Biology 2024Quote: ... and validated using Agilent High Sensitivity DNA Kit on a Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). The size range of the DNA fragments was measured to be in the range of app ...
-
bioRxiv - Cell Biology 2024Quote: ... and the size distribution was confirmed with High Sensitivity DNA Kit for Bioanalyzer (Agilent Technologies #5067-4626). Libraries were sequenced on Illumina NextSeq 500 in single read mode with read length 76 bp following manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2024Quote: ... Per reaction 200 ng RNA was amplified and Cy3-labeled using the LIRAK kit (Agilent; #5190-2305) following the kit instructions ...
-
bioRxiv - Molecular Biology 2024Quote: Mpro mutants were generated using the QuikChange® II Site-Directed Mutagenesis Kit from Agilent (Catalog #200524), using pET-SUMO-Mpro (from strain BetaCoV/Wuhan/WIV04/2019 ...
-
bioRxiv - Synthetic Biology 2024Quote: The SrIRED gene was amplified with error-prone PCR using the GeneMorph II random mutagenesis kit (Agilent) following the instructions of the manufacturer using 2.4 µg template plasmid and 25 PCR cycles ...
-
bioRxiv - Neuroscience 2024Quote: ... The quality of the libraries was checked on the Agilent Bioanalyzer with High Sensitivity DNA kit (Agilent); per sample libraries were sequenced on Illumina Novaseq 6000 with target sequencing depths of 25,000 -70,000 reads per nucleus.
-
bioRxiv - Neuroscience 2024Quote: ... Integrity of RNA samples was assessed using RNA 6000 Nano Kit (Agilent Technologies, Santa Clara, CA, USA) prior to library preparation ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA integrity was assessed by RNA 6000 Nano Reagent kit on a Agilent 2100 Bioanalyzer (Agilent Technologies) (Carli et al. ...
-
bioRxiv - Pathology 2023Quote: ... additional biotinylation of the primary antibody was performed using Dako Animal Research Kit Peroxidase (K3954, Dako, Denmark). Additionally ...
-
bioRxiv - Neuroscience 2024Quote: ... The quality and quantity of RNA were confirmed using NanoDrop and Bioanalyzer RNA 6,000 nano Kit (Agilent). Samples with RNA integrity number values exceeding 6.5 were used for RNA sequencing ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Point mutations were generated using the QuikChange II XL site-directed mutagenesis kit (Agilent, Santa Clara, CA) and confirmed by direct sequencing (GENEWIZ) ...
-
bioRxiv - Developmental Biology 2024Quote: ... concentrations of cDNA (50-9000 bp) samples were determined by the Bioanalyzer (Agilent, High Sensitivity DNA kit). 250 pg cDNAs were then used for tagmentation-based library preparation ...