Labshake search
Citations for Agilent :
301 - 350 of 2371 citations for R 4 5 Isopropylidene 2 pentanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... Mayer’s Hematoxylin (Agilent Technologies, S330930-2) was removed from each well and then each section was washed with 75µL of RNase and DNase free MQ water ...
-
bioRxiv - Physiology 2023Quote: ... and DAB (K346811-2; Agilent Technologies). Slides were counter stained with Mayer’s Hematoxylin (TA-125-MH ...
-
bioRxiv - Cancer Biology 2023Quote: ... protein blocker (Agilent Technology, X090930-2). Slides were incubated with a biotinylated anti-pimonidazole mouse IgG1 monoclonal antibody diluted 1:50 in Background Sniper (Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 mM glutamine (Agilent 103579-100), and 10 mM glucose (Agilent ...
-
bioRxiv - Genomics 2024Quote: ... Citrate pH 6 (Dako, S236984-2) at 100°C for CD206 and CD86 ...
-
bioRxiv - Biochemistry 2021Quote: ... at 4°C overnight diluted in antibody diluent (Dako). Negative controls were incubated with antibody diluent only ...
-
bioRxiv - Cell Biology 2020Quote: ... elegans V2 4*44K Microarray chip (Agilent Technologies, USA) at 65°C for 17 hrs ...
-
bioRxiv - Microbiology 2023Quote: ... which are handled with a stacker (BioStack 4, Agilent Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... cytokeratin (DAKO, Cat. M3515; 1:100 at 4 °C), ki67 (ThermoFisher ...
-
bioRxiv - Cell Biology 2021Quote: ... An inducible V-1 expression plasmid was created by first PCR- amplifying the mtpn gene with V-1 F and V-1 R oligos (dictyBase:DDB_G0268038) using Ax2 genomic DNA then TA cloning the product using StrataClone (Agilent) to generateV-1 SC ...
-
bioRxiv - Microbiology 2020Quote: ... the primer pair dsbS(H235A)-F/R and a QuikChange II site-directed mutagenesis kit (Stratagene, catalog#:200518) were used ...
-
bioRxiv - Cell Biology 2023Quote: ... These data analysis was performed in the R computing environment and GeneSpring GX software version 13.0 (Agilent Technologies).
-
VPS13B is localized at the cis-trans Golgi complex interface and is a functional partner of FAM177A1bioRxiv - Cell Biology 2023Quote: ... and a randomly selected subset of these embryos was assayed for the target locus disruption through genotyping PCR using vps13b_geno_F/R primers (see Supplementary materials Table S1) and resolving the resulting PCR products on Fragment Analyzer (Agilent).
-
bioRxiv - Systems Biology 2020Quote: ... lyophilized samples were resuspended in Buffer A (5 mM NH4HCO2/ 2% ACN) and 5 mg peptide material (5 mg/ml) was loaded onto a reversed phase column (ZORBAX 300Extend-C18, Agilent). Peptides were separate at a flow rate of 2 ml/min and a constant column temperature of 40 °C using a binary buffer system ...
-
bioRxiv - Biochemistry 2020Quote: ... 50 Pulsed-splitless injection was used to inject 5 μL samples onto an HP-5ms (5%-phenyl)-methylpolysiloxane capillary GC column (Agilent Technologies ...
-
bioRxiv - Biochemistry 2022Quote: ... SEC profiles for the KWOCAS (Figures 2,3,5 and Supplementary Figure S7) were obtained by high pressure liquid chromatography on an Agilent Bio SEC-5 column (Agilent) at a flow rate of 0.35 mL/min by injection of 10 μL of purified eluate using a mobile phase of Tris-buffered saline (50 mM Tris pH 8 ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Plant Biology 2024Quote: ... A splitless injection volume of 1 μL was injected onto an HP-5 column with 5% phenyl methylpolysiloxane stationary phase (Agilent) with dimensions of 30 m x 0.25 mm x 0.25 μm ...
-
bioRxiv - Developmental Biology 2024Quote: ... By site-directed mutagenesis the V5 tag of the pMT-Bip V5-His A vector was replaced by a Myc sequence (EQKLISEEDL) using the primers: Fw: 5’– AGCGAAGAGGATCTGACGCGTACCGGTCATCAT–3 and 5’– AATCAGTTTCTGTTCGAATTCCACCACACTGGACTAGTAGGTACC–3’ and the PFU ultra (Agilent). The cDNA for Drospondin without the signal peptide sequence and the stop codon was amplified using the clone GH02025 from Drosophila Genome Resource Center (DGRC) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Secondary antibodies (HRP linked) were swine anti–rabbit (P039901-2) and goat anti–mouse (P044701-2) (DAKO). Imaging was done using SuperSignal West Femto (ThermoFisher ...
-
bioRxiv - Plant Biology 2020Quote: ... Mega BE-C18 (5 g, 20 ml; Agilent), was conditioned with 100 ml of 100% methanol and equilibrated with 50 ml of deionized water ...
-
bioRxiv - Neuroscience 2020Quote: ... with the 5×SRE-Luc reporter plasmid (Stratagene) and EF1αLacZ (β-galactosidase [β-Gal]) ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Physiology 2022Quote: ... 5 μm column (Agilent p/n 993967-902). For the HPLC ...
-
bioRxiv - Immunology 2024Quote: ... and 5 µM InfinityLab deactivator additive (Agilent Technologies).
-
bioRxiv - Neuroscience 2023Quote: ... RNA Integrity Number (RIN) ≥5 (2100 Bioanalyzer, Agilent), and in the AD group ...
-
bioRxiv - Neuroscience 2024Quote: ... blocked and permeabilized with 5% goat serum (Dako) and 0.1% Triton X-100 (Sigma ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μm (Agilent Technologies, Santa Clara, CA, USA) under isocratic conditions (0.1 M sodium acetate buffer ...
-
bioRxiv - Genomics 2021Quote: ... Quality and size distribution of the captured genomic segments were verified by TapStation nucleic acids system (Agilent) assessments of regular or bisulfite-converted libraries ...
-
bioRxiv - Zoology 2021Quote: ... The amino acid composition of the hydrolyzed samples was determined using High Performance liquid Chromatography (HPLC-Agilent 1260 Infinity series ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were acidified with 1% formic acid (FA) and purified using OMIX C18 Mini-Bed tips (Agilent) prior to LC-MS/MS analysis.
-
bioRxiv - Neuroscience 2023Quote: ... 0-8 min with 0.1% formic acid) and a C-18 column (4.6 × 50 mm, 1.8 μm) (Agilent). Each compound was assessed in triplicate ...
-
bioRxiv - Neuroscience 2023Quote: ... 0-8 min with 0.1% formic acid) and a (C-18 column (4.6 × 50 mm, 1.8 μm) (Agilent). The photoproducts of DEAC-OXM were generated and analyzed in an analogous manner ...
-
bioRxiv - Physiology 2024Quote: ... Total bile acids assay (Diazyme Laboratories, CA, USA) and BioTek Epoch Microplate Spectrophotometer (Agilent Technologies, CA, USA) were used to measure total BA concentrations to determine the volume of cholestyramine-untreated extract needed to add for a final concentration of ∼300 μM BAs in the ileal explant culture media ...
-
bioRxiv - Immunology 2024Quote: ... Amino acid substitutions in G12V-TCR were generated by quick-change site-directed PCR mutagenesis (Agilent, USA). TCRs were transiently transfected into 293T-mCD3-GFP cells and stained separately with PE anti-mTCRβ mAb (Biolegend ...
-
bioRxiv - Microbiology 2023Quote: ... Cellular fatty acids were extracted and determined from dried cells by using GC (model 7890A, Agilent, USA) according to the protocol of the Sherlock Microbial Identification System (61) ...
-
bioRxiv - Microbiology 2023Quote: ... Amino acid analysis was performed by high-pressure liquid chromatography (HPLC) (Agilent 1100; Agilent Technologies, Massy, France) with a guard cartridge and a reverse phase C18 column (Zorbax Eclipse-AAA 3.5 μm ...
-
bioRxiv - Cell Biology 2024Quote: The Peptide nucleic acid (PNA) probe hybridisation of chromosome spreads followed the manufacturers guidelines (DAKO Agilent & PNAbio). Chromosome spreads were fixed in 3.7% PFA and washed using a gradient ice-cold ethanol wash series 70% ...
-
bioRxiv - Cell Biology 2024Quote: The Peptide nucleic acid (PNA) probe hybridisation of chromosome spreads followed the manufacturers guidelines (DAKO Agilent & PNAbio). Chromosome spreads were fixed in 3.7% PFA and washed using a gradient ice-cold ethanol wash series 70% ...
-
bioRxiv - Plant Biology 2024Quote: ... Amino acid contents were measured using a triple quadrupole LC-MS/MS system (Agilent 6420, CA, USA) with a Discovery HS-F5 column (2.1 × 250 mm ...
-
bioRxiv - Biochemistry 2024Quote: ... Bond Elut PBA (phenylboronic acid) cartridge and 96-well plate were purchased from Agilent (Santa Clara, USA). 1 µM of q and Q was spiked in human plasma and extracted with SPE cartridges ...
-
bioRxiv - Microbiology 2024Quote: ... and dispensed 30% acetic acid using the BioTek EL406 microplate washer/dispenser (Agilent, Santa Clara, CA, USA). The absorbance of CV-stained biofilms was recorded at 590 nm ...
-
bioRxiv - Biochemistry 2021Quote: ... protein samples were diluted to a final concentration of 5 µM with solvent A and then desalted on a reverse phase-C8 cartridge (Zorbax 300SB-C8, 5 µm, 300 µm ID 5 mm, Agilent Technologies) at a flow rate of 50 μl/min for 3 min with 100 % solvent A and subsequently eluted with 70 % solvent B for MS detection ...
-
bioRxiv - Systems Biology 2020Quote: ... 1 μl of each sample containing 2 μg of total native peptides and 100 fmol of each standard peptide was loaded on a precolumn Zorbax 300SB-C18 (5 μm, 5 × 0.3 mm) (Agilent Technologies, USA) and washed with 5 % acetonitrile for 5 min at a flow rate of 10 μl/minute before analytical LC separation ...
-
bioRxiv - Microbiology 2020Quote: ... n-dodecane samples were subjected to the Agilent 6890N gas chromatograph equipped with a (5%-phenyl)-methylpolysiloxane HP-5 column (length, 30 m; inside diameter, 0.32 mm; film thickness, 0.25 mm; Agilent Technologies, Ratingen, Germany) and a flame ionization detector (FID) ...
-
bioRxiv - Molecular Biology 2023Quote: ... together with Agilent Bio SEC-5 guard column (2000 Å, 7.8 × 50 mm, 5 µm particles) was connected to the Agilent 1200 HPLC system (Agilent Technologies) and equilibrated with 2 column volumes (CV ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 μL of sample was injected in a reverse phase column (Agilent PLRP-S 2.1 x 50 mm 100A 5 μm) held at 60 °C and eluted with a water-to-acetonitrile gradient from 95% to 50% water ...
-
bioRxiv - Microbiology 2022Quote: The supernatant and extract fractions were dissolved in 0.1% TFA solution in deionized water and applied to Agilent Prep 5 C18 column (10 x 250 mm, particle size 5 μm, Agilent Technologies). The processed McCYps and McCEco were first purified in 0.1% TFA/acetonitrile system in a linear 1-13% gradient of acetonitrile ...
-
bioRxiv - Microbiology 2022Quote: ... resuspended in 0.1% TFA in MQ and applied to Agilent 5 Prep-C18 RP-HPLC column (250 x 10 mm, particle size 5 μM, Agilent Technologies). The purification of Asp-pNA was carried out in a linear 5-25% gradient of acetonitrile ...
-
bioRxiv - Immunology 2023Quote: ... Rabbit anti-goat IgG (P044901-2) or goat anti-rabbit IgG (P044801-2) secondary antibodies were from Agilent.