Labshake search
Citations for Agilent :
501 - 550 of 2371 citations for R 4 5 Isopropylidene 2 pentanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... Reverse primer: 5’GTTGCAGCATGTTTCAGATGAT3’ with paq polymerase 5000 (Agilent, USA) and resulting PCR products were electrophoresed on 3% agarose gel ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Mouse Anti-Enterovirus Clone 5-D8/1 (Dako M7064) to identify CVB VP1 region ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytokeratin 5/6 (mouse monoclonal, clone 6D5/16 B4, Dako), epidermal growth factor receptor (EGFR ...
-
bioRxiv - Pathology 2024Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). The fluorescence of SNARF-5F were measured in a time dependent manner using Synergy Neo2 (Agilent/BioTek ...
-
bioRxiv - Biophysics 2023Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). For the I-/Cl- antiport assay ...
-
bioRxiv - Cancer Biology 2022Quote: ... C18 cartridges (Agilent, 5 μL bead volume, 150 μg capacity) were primed using 100 μL of 90% acetonitrile and equilibrated with 70 μL of 0.1% TFA at 10 μL/min ...
-
bioRxiv - Bioengineering 2022Quote: Images were captured in Cytation 5 (Agilent, Santa Clara, CA) and processed with ImageJ (NIH ...
-
bioRxiv - Microbiology 2022Quote: ... Fluorescence was measured using a Cytation 5 plate reader (Agilent).
-
bioRxiv - Developmental Biology 2023Quote: ... A 30 m HP-5 MS UI (Agilent J&W) column (0.25 mm ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.3% Triton X-100 with 5% Goat Serum (Dako #X090710)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... anti-mouse-HRP at 5 µg/ml (Dako, Cat # P0447).
-
bioRxiv - Molecular Biology 2024Quote: ... The 5’-dimethoxytrityl group was retained for HPLC purification (Agilent PLRP-S column ...
-
bioRxiv - Microbiology 2024Quote: ... and the plates were read with a Cytation 5 (Agilent) plate reader ...
-
bioRxiv - Immunology 2024Quote: ... endogenous peroxidases were blocked for 5 minutes (Agilent, ref. SM801) and then the slides were incubated with CD8 antibody (Histosure ...
-
bioRxiv - Molecular Biology 2024Quote: ... which is 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases were 95% ultrapure water with 0.1% (v/v ...
-
bioRxiv - Molecular Biology 2024Quote: ... which was 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases were 95% ultrapure water with 0.1% (v/v ...
-
bioRxiv - Molecular Biology 2024Quote: ... which is 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases were 70% 10 mM ammonium sulfate and 30% methanol ...
-
bioRxiv - Neuroscience 2024Quote: ... and counter stained for 5 minutes with automated hematoxylin (DAKO). Slides were then dehydrated through alcohol gradients and xylene before being coverslipped.
-
bioRxiv - Molecular Biology 2024Quote: ... which is 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases of first-step HPLC separation were 95% ultrapure water with 0.1% (v/v ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The column (C18, 5 µm, 250 × 4.6 mm, Agilent, USA) was eluted at 30 °C using acetonitrile/water (4/6 ...
-
bioRxiv - Cancer Biology 2024Quote: ... for 30min and imaged on the Cytation 5 (Agilent Technologies) using DAPI and RFP filters/LED cubes ...
-
bioRxiv - Cancer Biology 2024Quote: ... every 2nd day with a Cytation 5 instrument (Agilent Technologies). On day 7 ...
-
bioRxiv - Cell Biology 2024Quote: ... Plates were read using a BioTek Cytation 5 (Agilent Technologies) wide-field imaging reader with a 20x air objective ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were washed 2 times with 200 μL of extracellular flux assay medium (DMEM with 25 mM glucose, 2 mM sodium pyruvate, and 2 mM L-glutamine for mitochondrial stress test (Agilent Technologies). Assay medium was then added to each well to make the final well volume 180 uL ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were washed 2 x 15 min in PBST and 2 x 15 min in PBS and coverslipped with Fluorescence Mounting Medium (DAKO #S3023).
-
bioRxiv - Neuroscience 2022Quote: ... was determined in primary astrocytes by measuring ECAR under basal conditions and in response to 0.5μM/0.5μM rotenone/antimycin A and 50 mM 2-deoxyglucose (2-DG) (all XFp Glycolytic Rate Assay Kit, Agilent Technologies, 103346-100) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cell number and viability were assessed every 2 days for 2 weeks by flow cytometry on an ACEA NovoCyte 2060 (Agilent, USA). ACEA NovoExpress (Agilent ...
-
bioRxiv - Cancer Biology 2023Quote: Murine glioma cells (similar low passage N1IC-1/2 and p53-1/2) were seeded in PLL coated XFe24 cell culture microplates (Agilent TEchnologies) at 1.8ᵡ104 cells per well in 250μL BFP (n=10 technical replicates for the baseline experiment and n=5 technical replicates for the cysteine/methionine deprivation experiment ...
-
bioRxiv - Immunology 2023Quote: ... Antigen retrieval was then performed for 20 minutes at 95°C using Lecia Epitope Retrieval Buffer 2 followed by treatment with Dako serum-free protein block (X090930-2, Agilent Dako) for 15 minutes to prevent non-specific binding of the antibody ...
-
bioRxiv - Immunology 2024Quote: ... we washed cells twice with 200 μL of assay medium (minimal DMEM with 25 mM glucose, 2 mM sodium pyruvate, and 2 mM L-glutamine (Agilent Technologies)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... oligomycin (1 µM) and 2-deoxy-D-glucose (2-DG) (50 mM) (Seahorse Glycolysis Stress Test Kit, Agilent Technologies, 103020-100). Analyses were performed with Wave software 2.3.0 ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Plant Biology 2020Quote: ... Hybridizations were done using a custom 4×44 k oligoarray (Agilent Technologies) that was previously described15,25 ...
-
bioRxiv - Molecular Biology 2021Quote: ... at 4°C overnight diluted 1:200 in antibody diluent (#S3022, Dako). Negative controls were incubated with antibody diluent only ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4×180K or 8×60K SurePrint G3 human CGH microarray (Agilent Technologies) according to manufacturer’s instructions (CGH enzymatic protocol v6.2 ...
-
bioRxiv - Immunology 2020Quote: ... FLAG-tagged YTHDF1 was cloned into pCMV-Tag 4 vector (Agilent, #211174); Myc-tagged DDX60 was cloned into pRK-5 vector (BD PharMingen ...
-
bioRxiv - Molecular Biology 2021Quote: ... Sections were incubated at 4°C with anti-VWF (1:200, Dako) and anti-α-smooth muscle actin (1:100 ...
-
bioRxiv - Genomics 2021Quote: ... diluted to 4 nM and QC’d on the Bioanalyzer (Agilent Technologies, USA). The final pool was sequenced on Illumina MiSeq platform 2×300 bp using the MiSeq Reagent Kit V3 (600 cycles PE ...
-
bioRxiv - Neuroscience 2024Quote: ... PSCs were then labeled with a S100 rabbit antibody (1:4, DAKO) for 2 h at RT ...
-
bioRxiv - Neuroscience 2024Quote: ... Wall air was passed through a hydrocarbon filter (Agilent Technologies, HT200-4) and split into a 100 mL/min odor stream and 900 mL/min carrier stream using analog flowmeters (Cole-Parmer ...
-
bioRxiv - Physiology 2023Quote: ... at 4 °C overnight and mounted with fluorescence mounting medium (Agilent, USA).
-
bioRxiv - Developmental Biology 2024Quote: ... The signal was detected with BioTek Synergy 4 Microplate reader (Agilent Technologies), and the results were analyzed using a 4-parameter logistic regression algorithm (http://www.elisaanalysis.com/app) ...
-
bioRxiv - Biochemistry 2024Quote: ... overnight at 4 °C) and blocking of endogenous peroxidase (peroxidase block; Dako) for 10 min at RT ...
-
bioRxiv - Microbiology 2020Quote: ... The 75th amino acid in the PB1-F2 protein was changed to a histidine (H) via site directed mutagenesis (QuikChange Lightning, Agilent) to produce the PB1-F2-75H plasmid ...
-
bioRxiv - Plant Biology 2020Quote: ... and fluorenylmethoxycarbonyl (FMOC) was based on the application note “Automated amino acids analysis using an Agilent Poroshell HPH-C18 Column” by Agilent. The samples were injected onto a 100 mm x 3 mm InfinityLab Poroshell HPH-C18 column (2.7 μm ...
-
bioRxiv - Cell Biology 2020Quote: Samples from all biological replicates were first sent to the Stanford University Protein and Nucleic Acid Facility (Stanford, CA) for quantification and quality analysis using a 2100 Bioanalyzer (Agilent). Samples were then sent to Novogene Corporation Inc ...
-
bioRxiv - Microbiology 2021Quote: ... Fatty acid methyl esters were identified by their mass spectrum and retention time and quantified by Mass Hunter Quantification Software (Agilent) and the calibration curve generated with fatty acid methyl esters standards mix (Sigma CRM47885) ...
-
bioRxiv - Biochemistry 2020Quote: ... The D614G amino acid change was introduced into VRC7480 by site-directed mutagenesis using the QuikChange Lightning Site-Directed Mutagenesis Kit from Agilent Technologies (Catalog # 210518) ...
-
bioRxiv - Immunology 2020Quote: ... The codon encoding residue 241 of Copa was mutated from glutamic acid to lysine via Quikchange Lightning site directed mutagenesis (Agilent). Following NotI and PacI digestion ...
-
bioRxiv - Microbiology 2020Quote: ... Hydrolyzed amino acids were separated using ultra performance liquid chromatography (UPLC, Acquity, Waters) on a C-8 column (Zorbax Eclipse XBD, Agilent) at a flow rate of 0.6 mL/min ...