Labshake search
Citations for Agilent :
301 - 350 of 954 citations for Human MMP24 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... LECs were additionally co-stained with mouse anti-human CD31 antibody (clone JC70A, Dako) at a dilution of 1:50 ...
-
bioRxiv - Developmental Biology 2019Quote: ... and processed by SureSelectXT Human All Exon V5 (Agilent Technologies, Santa Clara, CA, USA). Captured DNA was sequenced using HiSeq 2000 (Illumina ...
-
bioRxiv - Cancer Biology 2020Quote: The one-color microarray Human miRNA Microarray Kit (V2) design ID 029297 from Agilent Technologies was used to measure miRNA expression for 425 tumors of the Oslo2 cohort using 100 ng total RNA as input ...
-
bioRxiv - Bioengineering 2022Quote: ... The CGH assays were performed using the SurePrint G3 Human CGH Microarray Kit (Agilent) and the genomic DNA of WTC11 cells as a reference of the diploid cells ...
-
bioRxiv - Genomics 2019Quote: ... The BED files describing the exome capture regions (SureSelect Human All Exon V5, Agilent) were lifted over using the paftools liftover command ...
-
bioRxiv - Immunology 2022Quote: ... IgG binding was detected by incubation with Cy3-rabbit anti-human IgG (Dako Cytomation) labeled according to the manufacturer’s recommended protocols (GE Healthcare) ...
-
bioRxiv - Genomics 2019Quote: An RNA library was first created by pooling the Universal Human Reference RNA (Agilent) with SIRV Isoform Mix E0 (Lexogen) ...
-
bioRxiv - Neuroscience 2020Quote: ... Anti-Fgb (rabbit) and anti-human Pecam1 (mouse) were from Dako (Carpinteria, CA, USA). Anti-Alb (sheep ...
-
bioRxiv - Genomics 2019Quote: ... Antibodies used included mouse monoclonal anti-human CD3 (DAKO, clone F7.2.38, dilution 1:50) and mouse monoclonal anti-human CD8 (DAKO ...
-
bioRxiv - Immunology 2022Quote: ... tissue sections were firstly stained with monoclonal anti-human CD45 (DAKO, 2B11+PD7/26), CD20 (DAKO ...
-
bioRxiv - Immunology 2020Quote: ... which were then hybridized to SurePrint G3 Human Gene Expression 60K GeneChip microarrays (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... Antigen-specific IgG was detected using rabbit anti-human IgG HRP (Dako, Glostrup, Denmark). ELISA plates were developed using TMB solution (Life Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... Exome capturing was performed using SureSelect Human All Exon in-solution capture reagents (Agilent). In case RNA was pooled in for sequencing ...
-
bioRxiv - Immunology 2023Quote: ... or IgA (polyclonal rabbit anti-human IgA/HRP, Dako, P0216, at 1:2000 dilution) was added for 1 hr at room temperature and the enzyme reaction was developed with TMB plus (Kementec ...
-
bioRxiv - Systems Biology 2023Quote: ... 50 Mb targeted exons were captured using SureSelect Human All Exon V5 (Agilent Technologies). Hundred bp paired-end sequence reads of the captured exons were generated using HiSeq 2000 Sequencing System (Illumina ...
-
bioRxiv - Biophysics 2023Quote: Human FKBP12.6 cDNA was modified by site directed mutagenesis (QuikChange Lightning kit; Agilent Technologies) to introduce one of eight single cysteine mutants (G1C ...
-
bioRxiv - Cell Biology 2022Quote: ... Calibrator cDNA was transcribed from Quantitative PCR Human Reference Total RNA (Agilent Technologies, USA). Relative gene expression was calculated upon normalisation to two reference genes ...
-
bioRxiv - Immunology 2023Quote: ... Antigen-specific IgG was detected using rabbit anti-human IgG HRP (Dako, Glostrup, Denmark). ELISA plates were developed using TMB solution (Life Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... Library preparation was performed by using SureSelectXT Human All Exon V5 (Agilent, 5190–6209) according to the instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... DNA library hybridization was performed by using Agilent SureSelect Human All Exon V6 (Agilent). Paired-end sequencing (150 bp ...
-
bioRxiv - Microbiology 2024Quote: ... for 24 h or by 15 µg/ml α-human IgG (Agilent #A042301-2) for 48 h ...
-
bioRxiv - Neuroscience 2019Quote: Mutations to plasmids were created with Quikchange II site-directed mutagenesis kit (Agilent). Sequences for primers used in mutations are found in table S1.
-
bioRxiv - Microbiology 2019Quote: ... Point mutations were introduced into plasmid-encoded viral cDNAs using QuikChange mutagenesis (Agilent) according to the manufacturer’s protocol.
-
Vasohibin1, a new IRES trans-acting factor for sequential induction of angiogenic factors in hypoxiabioRxiv - Cell Biology 2019Quote: ... VEGFA or EMCV IRESs was cloned in pSCB-A-amp/kan plasmid (Agilent) downstream from the T7 sequence ...
-
bioRxiv - Biophysics 2021Quote: ... Plasmids were constructed using Gibson Assembly and cloned using XL1-BLUE (Agilent Technologies) E ...
-
bioRxiv - Cancer Biology 2020Quote: ... S838A/T841A substituted plasmid was made with QuikChange Site-directed mutagenesis kit (Agilent), following manufacturer’s recommendations and mutagenic primers TTAGTATCAATTGGTGAAGCATTCGGGGCTTCT GAGAAGTTCCAGAAA and TTTCTGGAACTTCTCAGAAGCCCCGAATGCTT CACCAATTGATACTAA ...
-
bioRxiv - Biophysics 2020Quote: Plasmids were transformed into BL21-CodonPlus(DE3)-RIPL competent cells (Agilent Technologies #230280). A single colony was inoculated in 1 mL of terrific broth (TB ...
-
bioRxiv - Microbiology 2020Quote: ... and all remaining plasmids were generated through site-directed mutagenesis (QuickChange Lightning, Agilent) or cut- and-paste cloning ...
-
bioRxiv - Biochemistry 2021Quote: pMtac expression plasmids were transformed into BL21-Codon Plus RIPL competent cells (Agilent). Expression of His6-tagged proteins were induced at 16°C overnight with 0.25 mM IPTG ...
-
bioRxiv - Neuroscience 2022Quote: ... the plasmid was transformed into BL21-CodonPlus (DE3)-RIPL competent cells (Agilent, #230280). A single colony was inoculated in 1-mL TB medium (Laboratory ...
-
bioRxiv - Genomics 2019Quote: ... The plasmid was transformed and expanded in XL10-Gold Escherichia coli strain (Stratagene). The cDNA of the plasmid was sent for Sanger sequencing to validate the gene sequence.
-
bioRxiv - Immunology 2021Quote: ... Mutant virus Env plasmid was generated by Quikchange site-directed mutagenesis kit (Agilent) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... plasmid pDG2 (PapCHis) was mutated using the QuikChange Site-Directed Mutagenesis Kit (Stratagene) and the primers listed in Extended Data Table 3 ...
-
bioRxiv - Immunology 2020Quote: ... and backbone plasmid pNL4-3.Luc.R-E-(NIH AIDS Reagent) using GeneJammer (Agilent) in 10% FBS/DMEM enriched with 1% Pennicilin/Streptomycin (D10 medium) ...
-
bioRxiv - Cell Biology 2022Quote: The HISp-GFP-Bub1 plasmid was mutagenised using the Quickchange lightning kit (Agilent), according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... a plasmid was transformed into BL21-CodonPlus(DE3)-RIPL competent cells (Agilent #230280), and a single colony was inoculated in 1 mL of TB with 50 µg/mL of chloroamphenicol and 25 µg/mL of carbenicillin or 15 µg/mL of kanamycin in the case of Sfp ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmids were transformed into Eschericia coli BL21-CodonPlus (DE3)-RIL cells (Agilent Technologies) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Mutant plasmids were generated using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent). ACADVL was a gift from Nicola Burgess-Brown (Addgene plasmid #38838 ...
-
bioRxiv - Cell Biology 2023Quote: The HISp-GFP-Mad1 plasmid was mutagenized using the Quickchange lightning kit (Agilent), according to the manufacturer’s instructions.
-
bioRxiv - Biophysics 2023Quote: ... plasmids were transformed into BL21-CodonPlus (DE3)-RIPL competent cells (Agilent Technologies, #230280) with heat shock at 42 ℃ for 45 seconds followed by incubation at 37 ℃ for 1 hour in SOC medium ...
-
bioRxiv - Cell Biology 2024Quote: ... Ligated plasmids were transformed into competent XL-1 blue cells (Agilent Technologies #200249). I440A and R479A MDM2 mutants were generated by site-directed mutagenesis ...
-
bioRxiv - Microbiology 2023Quote: ... The rVSV-SC2 S686G plasmid was obtained through site-directed mutagenesis (Quickchange, Agilent) using a pair of completely overlapping primers (5’-CTCGGCGGGCACGTGGTGTAGCTAGTC-3’ and 5’-GACTAGCTACACCACGTGCCCGCCGAG-3’) ...
-
bioRxiv - Molecular Biology 2023Quote: ... All other AAV6 vectors were cloned into the pAAV-MCS plasmid (Agilent Technologies), which contains inverted terminal repeats (ITRs ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by polyclonal Rabbit anti-human Glucagon (cat. A0565, Agilent Technologies, Santa Clara, CA, USA) diluted 1:500 in PBS 1X supplemented with 3% BSA ...
-
Reprogramming enriches for somatic cell clones with small scale mutations in cancer-associated genesbioRxiv - Genomics 2020Quote: ... Exomes were enriched using the commercially available Agilent SureSelectXT2 Human All Exon v4 (Agilent Technologies). 2µg of gDNA (> 3*105 cells ...
-
bioRxiv - Biochemistry 2019Quote: ... Mutagenesis of the human l/r-pyk gene was performed with a QuikChange kit (Stratagene). Proteins were expressed in the FF50 strain of Escherichia coli 8 that has both native E ...
-
bioRxiv - Genomics 2019Quote: ... and the Flex mouse anti-human CD31 antibody (clone JC70A, Dako North America, Carpinteria, CA) for 90 min ...
-
bioRxiv - Cancer Biology 2019Quote: ... and exomes were captured with SSELXT Human All exon V6 +UTR probes (Agilent Technologies, CA). Samples were sequenced on Illumina HiSeq 1500 sequencer or NovaSeq 6000 platform ...
-
bioRxiv - Biochemistry 2022Quote: ... coupled to a depletion column (human 14 multiple affinity removal column; 4.6 × 50 mm; Agilent) according to the manufacturer’s procedure ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-exome libraries were prepared using a SureSelectXT Human All Exon V5 kit (Agilent Technologies). The RNA seq library from tumor RNA was prepared using Illumina TruSeq Stranded mRNA Library Prep Kit as per the manufacturer’s instruction ...