Labshake search
Citations for Agilent :
451 - 500 of 954 citations for Human MMP24 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... Incubation with primary antibodies: mouse anti-human pan-Cytokeratin (1:50; clone A1/A3; Dako, Hamburg, Germany), rat anti-mouse CD31 (1:200 ...
-
bioRxiv - Genomics 2020Quote: ... A corresponding screenshot showing read visualization when using the SureSelect Human All Exon V6 kit from Agilent is presented in Figure 5 ...
-
bioRxiv - Cancer Biology 2020Quote: Sections were stained with mouse or rabbit anti-human monoclonal antibodies against CD20 (Dako, L26, 1:200), CD21 (DAKO ...
-
bioRxiv - Genetics 2022Quote: ... WES was performed using the SureSelect XT Human All Exon V6 kits (Agilent, Santa Clara, CA, USA). CLC Genomics Workbench version 7.0.5 (CLCBio ...
-
bioRxiv - Neuroscience 2020Quote: ... 2% BSA in 0.1% PBS-Tx and stained with rabbit anti-human tau antibodies (1:1000; Dako) or mouse anti-phospho tau PHF-1 (1:1000 – thermofisher) ...
-
bioRxiv - Neuroscience 2021Quote: Target enrichment made use of the SureSelectTX human all-exon library (V6, 58 mega base pairs; Agilent) and high-throughput sequencing was carried out using a HiSeq4,000 (2×75-base-pair paired-end configuration ...
-
bioRxiv - Immunology 2022Quote: ... anti-human IgG was diluted 1:1000 in assay buffer and Cy3-rabbit antihuman IgG (Dako Cytomation) by incubation for 2 h at room temperature according to the manufacturer’ ss recommendations ...
-
bioRxiv - Neuroscience 2021Quote: Target enrichment made use of the SureSelectTX human all-exon library (V6, 58 mega base pairs; Agilent) and high-throughput sequencing was carried out using a HiSeq4,000 (2×75-base-pair paired-end configuration ...
-
bioRxiv - Cancer Biology 2019Quote: ... before incubation with mouse anti-human CD68 antibody at 1:100 dilution (M0876, Dako UK Ltd, Ely) for 1 hour at RT ...
-
bioRxiv - Molecular Biology 2020Quote: ... then sent to the Plateforme Génomique de Nantes for hybridization on SurePrint G3 human exon microarrays (Agilent). Raw signals were LOWESS-normalised before analysis ...
-
bioRxiv - Genomics 2021Quote: ... and the exonic regions were captured with Agilent SureSelect Human All Exon v7 Kit (Agilent, 5191-4005). Whole exome sequencing (WES ...
-
bioRxiv - Genomics 2020Quote: ... III14 and IV9 in this family by using SureSelect Human All Exon Kit (Agilent, Santa Clara, CA) to capture the exome and HiSeq2000 platform (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: Full-length human Plk3 (1-646 aa; accession number NM_004073) cloned into a pCMV-Tag2A vector (Stratagene) to construct a Flag-tagged expression plasmid was described previously (Li et al. ...
-
bioRxiv - Cancer Biology 2022Quote: Comparative genome hybridization was performed using the Agilent SurePrint G3 Human CGH 60 K microarray (Agilent Technologies) spanning the entire human genome at a median resolution of 41 kb ...
-
bioRxiv - Molecular Biology 2022Quote: contains the canonical human HELZ2 long isoform cDNA (2649 bps) cloned into pCMV-3Tag-9 (Agilent Technologies), which allows the expression of a HELZ2-3xMYC fusion protein ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary anti-human von Willebrand factor (VWF) antibody (1:1000 dilution in PBS, LOT # 75601, Agilent Dako) was incubated overnight at 4°C ...
-
bioRxiv - Cancer Biology 2022Quote: The exome was captured using Agilent SureSelect Human All Exon V5 kit (Agilent, Santa Clara, CA, US) and sequenced in a HiSeq instrument (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were immunoblotted with the following primary antibodies: polyclonal rabbit Anti-Human Tau (1:10 000, Dako) and monoclonal mouse Anti-Actin (1:25 000 ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary anti-human von Willebrand factor (VWF) antibody (1:1000 dilution in PBS, LOT # 75601, Agilent Dako) was incubated overnight at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... rAAVs were produced by co-transfection of human embryonic kidney (HEK) cell line 293 (Stratagene, California, USA) with the target AAV plasmid and helper plasmids (pFΔ6 ...
-
bioRxiv - Cancer Biology 2024Quote: ... the pre-capture libraries containing exome sequences were captured using SureSelect Human All Exon V6 kit (Agilent). DNA concentration of the enriched sequencing libraries was measured with the Qubit 3.0 fluorometer dsDNA HS Assay (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2024Quote: ... ab109401 (1:5000)) or and anti-total Tau antibody (rabbit anti-human Tau, Dako, #A0024 (1:5,000)) diluted in 3% BSA in PBS-T overnight at 4°C shaking ...
-
bioRxiv - Cell Biology 2024Quote: ... The following primary antibodies were used: anti-keratin 20 (KS.20.8, mouse monoclonal anti-human; Agilient-Dako), anti-PCNA (PC-10 ...
-
bioRxiv - Biochemistry 2024Quote: K125R and K125E mutations of human connexin 26 were prepared using the QuikChange II mutagenesis kit (Agilent) and the following primers ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 µg of plasmid ASAP3 and ASAP3-R3 were added into the solution of GeneJammer (Agilent) transfection reagent in Opti-MEM (3 µL in 200 µL) ...
-
bioRxiv - Immunology 2021Quote: Spike-expressing plasmid constructs were generated using the QuikChange Lightning Multi Site-Directed Mutagenesis kit (Agilent) on a previously described Wuhan-hu-1 template34 ...
-
bioRxiv - Microbiology 2021Quote: ... Mutations were introduced into the pMicC plasmid using a QuikChange Lightning site-directed mutagenesis kit (Stratagene). Oligonucleotides used in this study are listed in Table S2.
-
bioRxiv - Plant Biology 2021Quote: ... Plasmids used for rice transformation were created by site-directed mutagenesis (Quikchange lightning technology, Agilent technologies) to introduce point mutations in the genomic sequence of RGA5 already cloned in pAHC17 ...
-
bioRxiv - Immunology 2021Quote: ... ORF9 mutant plasmids were generated using site directed mutagenesis (QuikChange II Site-Directed Mutagenesis Kit, Agilent). GST-fusion bacterial expression vectors for FLAG-ORF9 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Longer inserts flanked by longer homology arms were cloned into pBluescript II KS-plasmid (Agilent Technologies). All TALEN and Cas9 target sequences and donor sequences for homologous recombination are listed in Table S1 ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV vectors were generated by triple transfection of 293T/17 cell line using Polyethylenimine (PEI) and plasmids pAAV-hsynapsin-HA-ΔN-DGKκ or pENN.AAV.hSynapsin.EGFP.RBG together with pHelper (Agilent) and pAAV2/9 or pAAV2/Rh10 (provided by J.Wilson and J.Johnston at Penn Vector Core) ...
-
bioRxiv - Cell Biology 2020Quote: ... All mutations in the plasmids were generated by site-directed mutagenesis using a QuikChangeII kit (Agilent) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... All mutations in the plasmids were generated by site-directed mutagenesis using a QuikChangeII kit (Agilent) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: All AAV6 vectors were cloned into the pAAV-MCS plasmid (Agilent Technologies, Santa Clara, CA, USA), which contains inverted terminal repeats (ITRs ...
-
bioRxiv - Cell Biology 2021Quote: ... The pEGFP-C2-Myo15-2(jd) plasmid was generated using site directed mutagenesis (QuikChange II, Agilent) to introduce the jordan (c.4940A>G ...
-
bioRxiv - Neuroscience 2022Quote: ... together with 40 ng/μl of a transfection reporter plasmid encoding humanized Renilla GFP (hrGFPII; Stratagene) and 0.01% Fast Green (AppliChem).
-
bioRxiv - Biochemistry 2023Quote: ... the plasmid was transformed into BL21-Gold (DE3) competent cells (Agilent Technologies, Santa Clara, CA, USA) and inoculated onto LB agar plate supplemented with 50 ug/ml kanamycin.
-
bioRxiv - Biophysics 2023Quote: ... The WT and high-specificity Rec3 plasmids were transformed into BL21-Gold (DE3) competent cells (Agilent) and expressed in lysogeny broth (LB ...
-
bioRxiv - Microbiology 2023Quote: ... Mutagenesis of the different plasmids was achieved using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent). All plasmids were freshly transformed into the appropriate strains before each of the experiments.
-
bioRxiv - Bioengineering 2023Quote: ... In silico assembly and de novo synthesis of transformation plasmids using pBluesript II KS (+) (Stratagene, USA) as the backbone vector was done in the Snapgene (software v ...
-
bioRxiv - Biochemistry 2023Quote: ... SUV420H1 plasmid was transformed into Escherichia coli BL2-codon plus (DE3)-RIL competent cells (Agilent technologies) and grown in 2xYT-Kan media ...
-
bioRxiv - Biochemistry 2023Quote: ... The BDF1 point mutant plasmids were obtained using the QuikChange II Site-directed mutagenesis kit (Agilent) with the BDF1 plasmid pJG267 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV plasmids were packaged into AAV serotype 9 using the AAV Helper-Free system (Agilent Technologies). In brief ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV plasmids were packaged into AAV serotype 9 using the AAV Helper-Free system (Agilent Technologies). In brief ...
-
bioRxiv - Biochemistry 2023Quote: ... Mutagenesis of the plasmids was performed with the indicated primers (Table S4) using PfuTurbo Polymerase (Agilent) followed by DpnI (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... H3.3 mutations were introduced into the pBabePuro dH3.3-IRES GFP plasmid using site-directed mutagenesis (Agilent). Plasmids were verified by sequencing ...
-
bioRxiv - Cell Biology 2023Quote: ... The P878A mutation was generated from the WT plasmid using the Quikchange Lightning mutagenesis kit (Agilent) and primers (CCTAGGCCTCCACCAGCAGAGGAAAAGGATG ...
-
Sex and species associated differences in Complement-mediated immunity in Humans and Rhesus macaquesbioRxiv - Immunology 2023Quote: ... Mutations in the wild type heavy chain plasmid were performed using site directed mutagenesis (Agilent, 200524) following the manufacturer’s protocol to generate EG ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.75 μg labeled cRNA was fragmented and hybridized to custom whole-genome human 8 × 60K microarrays (Agilent-048908) according to the supplier’s protocol (Agilent Technologies) ...
-
bioRxiv - Pathology 2022Quote: ... the hydrogels were incubated overnight with a mouse anti-human α-smooth muscle actin antibody (DAKO, Glostrup, Denmark) at 4°C ...