Labshake search
Citations for Agilent :
301 - 350 of 4446 citations for Dendritic Cell Specific Transmembrane Protein DCSTAMP Antibody Biotin since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: The Pol β proteins were transformed and expressed in BL21-CodonPlus (DE3)-RP Escherichia coli (E. coli) competent cells (Agilent). The transformed cells were grown at 37 °C to an OD600 of 0.6 and Pol β expression induced using 0.1 mM isopropyl-b-D-thiogalactopyranoside (IPTG ...
-
bioRxiv - Neuroscience 2020Quote: ... the samples were examined in a detergent insolubility assay adapted from Drisaldi et al.43 and the proteins in the supernatant and pellet were analyzed by Western blot using the anti-tau rabbit polyclonal antibody DAKO (Agilent Technologies Italy SpA, Milan, Italy) (1:10000 dilution) ...
-
bioRxiv - Cancer Biology 2023Quote: ... All oligo- conjugated antibodies were generated as previously described and were run on a Bioanalyzer Protein 230 electrophoresis chip (Agilent Technologies, cat. no 5067-1517) to verify successful conjugation6.
-
bioRxiv - Physiology 2020Quote: ... BrdU positive cells were detected with an anti-BrdU primary antibody diluted 1:100 (DAKO Cytomatation) and with an anti-mouse-Alexa488 conjugated diluted 1:100 (Thermofisher) ...
-
bioRxiv - Bioengineering 2021Quote: ... Immune cell infiltrate was detected using rabbit polyclonal antibodies against CD3 (1:500, Dako, Cat#A0452), and Iba-1 (ionized calcium binding adaptor protein ...
-
bioRxiv - Developmental Biology 2020Quote: ... To visualize Paneth cells the samples were stained with 1:500 primary antibody anti-lysozyme (Agilent) overnight at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were incubated with 50 µl Horse Radish Peroxidase (HRP-) conjugated goat anti-mouse antibody (Dako) (1:2000 in PBS-Tween ...
-
bioRxiv - Pathology 2020Quote: ... Antibodies were diluted in antibody diluent (Dako). Immunostained samples were analyzed with a fluorescence microscope (Olympus DP72) ...
-
bioRxiv - Cell Biology 2023Quote: ... primary antibodies prepared in antibody diluent (Agilent) were added for 8 hours at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: Purpose built rodent specific coils (circular coil 8mm in diameter and height-see [2]) controlled by an arbitrary waveform generator (Agilent 335141B) connected to a bipolar power supply (Kepco BOP 100-4M ...
-
bioRxiv - Molecular Biology 2020Quote: ... of the α-peptide sequence of the lacZ gene was amplified using Pfu DNA polymerase with specific primers (AlphaFor, CAGGAAACAGCTATGAC; AlphaRev, CCATTCGCCATTCAGGCTGCGCAA) and pBluescript KS- plasmid (Agilent Technologies) as a template ...
-
bioRxiv - Microbiology 2020Quote: ... ESI–MS in positive ionization mode were carried out for specific fractions and analyzed by TOF detector (Agilent 1200 series, USA).
-
bioRxiv - Genetics 2022Quote: RNA-sequencing libraries were prepared using the SureSelect Strand-Specific RNA Library Prep for Illumina Multiplexed Sequencing kit (Agilent, Cat#: G9691A) according to the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2022Quote: Samples were collected at specific time-points during the aggregation process and the scattering measured in a spectrophotometer (Agilent Cary 60) at 320 nm.
-
bioRxiv - Plant Biology 2021Quote: ... USA) using gene specific oligonucleotide (Supplemental table S3) and Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies, USA). Relative gene expressions were calculated using 2−ΔΔCt method ...
-
bioRxiv - Molecular Biology 2021Quote: ... Site-specific mutation of K674R was introduced in pQCXIP-FLAG-MD by using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: RNA-sequencing libraries were prepared using the SureSelect Strand-Specific RNA Library Prep for Illumina Multiplexed Sequencing kit (Agilent, Cat#: G9691A) according to the manufacturer’s protocol using 100 ng total RNA ...
-
bioRxiv - Immunology 2022Quote: Biotinylated MHC monomers with human β2-microglobulin specific for H-2Ld β-galactosidase (TPHPARIGL) were obtained from the NIH Tetramer Core Facility and tetramerized with streptavidin-PE (Prozyme). Decoy reagent was made according to published protocols (20) ...
-
bioRxiv - Cell Biology 2023Quote: ... Peak ion chromatograms for metabolites of interest were extracted at their specific m/z with Mass Hunter Quantitative Analysis software (Agilent Technologies). Ions used for quantification of metabolite levels were as follows ...
-
bioRxiv - Molecular Biology 2023Quote: ... Site-specific mutagenesis was performed according to standard procedures of the QuickChange Site-Directed Mutagenesis Kit purchased from Stratagene (GE Healthcare) or Mut Express II (Vazyme Biotech) ...
-
bioRxiv - Pathology 2024Quote: ... Van-Gieson as a specific elastin stain or labelled with alpha-smooth muscle actin (a-SMA, Cat#M0851, Dako, 1:1000) as a specific marker for muscle ...
-
bioRxiv - Cell Biology 2024Quote: ... Peak ion chromatograms for metabolites of interest were extracted at their specific m/z with Mass Hunter Quantitative Analysis software (Agilent Technologies). Ions used for quantification of metabolite levels were as follows ...
-
bioRxiv - Cell Biology 2023Quote: ... and the N-terminal 6xHis-tagged and C-terminal EGFP-tagged proteins were expressed in Arctic Express (DE3) RP cells (Agilent Technologies). Bacterial cultures in LB medium were induced with 0.1-0.2 mM IPTG at exponential growth phase (OD600 = 0.5-0.6 ...
-
bioRxiv - Neuroscience 2023Quote: Primary antibodies to the following proteins were used at the indicated concentrations: ubiquitin (1:1000, P4G7, BioLegend; 1:200 Cell Signaling; 1:200, Z0458, Dako), GABARAP (1:1,000 ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were washed thrice with 0.1% (v/v) tween-20 / PBS and incubated in Serum Free Protein Block (DAKO, cat.#X0909) for 1h at 21°C ...
-
bioRxiv - Cell Biology 2021Quote: ... and incubated in Protein Block (Dako) for 5 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... and protein (Dako cat. no. X0909) blocking reagents for 5 minutes each ...
-
bioRxiv - Cell Biology 2024Quote: ... Dako Protein Block (Agilent Cat#X0909), ‘Normal’ block (Agilent Cat#S202386-2) ...
-
bioRxiv - Microbiology 2023Quote: ... AdvanceBio SEC 300Å protein standard (Agilent) was included to correlate the elution volume with molecular weight.
-
bioRxiv - Microbiology 2023Quote: ... diluted with protein block buffer (Dako) for 2 hours ...
-
bioRxiv - Cancer Biology 2023Quote: ... protein blocker (Agilent Technology, X090930-2). Slides were incubated with a biotinylated anti-pimonidazole mouse IgG1 monoclonal antibody diluted 1:50 in Background Sniper (Fisher Scientific ...
-
bioRxiv - Bioengineering 2021Quote: ... All antibodies were diluted in Dako Antibody Diluent (Dako Antibody Diluent S0809; Agilent Technologies). Images were captured by confocal microscopy (Leica DMi8 ...
-
bioRxiv - Neuroscience 2020Quote: ... Primary antibodies were diluted in antibody diluent (Dako) and applied for 45 minutes at room temp ...
-
bioRxiv - Physiology 2022Quote: ... Primary antibodies were diluted in antibody diluent (Dako) and incubated overnight at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... Primary antibodies were diluted in Antibody Diluent (Dako) and a droplet of 25 µl or 50 µl applied on the sample for an 8-well or a coverslip upside down ...
-
bioRxiv - Neuroscience 2024Quote: ... Antibodies were diluted in antibody diluent (Dako, S0809) containing 0.3% Triton X-100 and incubated overnight at 4 °C in a humidified chamber ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primary antibodies were diluted in Antibody Diluent (Dako) and incubated overnight at 4 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... monoclonal) (Cell Signalling, Danvers, USA), β-actin (#3700, monoclonal) (Cell Signalling, Danvers, USA), and secondary antibodies (P044801-2, polyclonal) from Dako (Agilent, Santa Clara, USA) were used at a dilution 1/1000 (primary ...
-
bioRxiv - Microbiology 2020Quote: Two different glycosidases were used for specific removal of N-glycans: peptide N-glycosidase F (PNGase F) and endo N-glycosidase H (Endo H) (Prozyme, Hayward, CA). PNGase F removes all N-glycans from gp120/41 glycoprotein whereas Endo H removes high-mannose and hybrid glycans ...
-
bioRxiv - Microbiology 2021Quote: ... Each uniquely indexed strand specific library was assessed for library size and amount using the Agilent DNA 1000 kit (Agilent Technologies, USA). After normalization and pooling ...
-
bioRxiv - Cancer Biology 2021Quote: Antibodies were diluted in antibody diluent (Dako, S302281-2). Nuclei were visualized by DAPI (Sigma ...
-
bioRxiv - Immunology 2022Quote: ... Antibodies were diluted in Background Reducing Antibody Diluent (Agilent). The tissue was subsequently incubated with an anti-rabbit HRP polymer (Leica ...
-
bioRxiv - Bioengineering 2021Quote: ... All antibodies were diluted in Dako Antibody Diluent (Dako Antibody Diluent S0809 ...
-
bioRxiv - Immunology 2021Quote: ... Antibodies were diluted in Background Reducing Antibody Diluent (Agilent). The tissue was subsequently incubated with an anti-rabbit HRP polymer (Leica ...
-
bioRxiv - Microbiology 2022Quote: ... primary antibodies and appropriate HRP-conjugated secondary antibodies (DAKO). A chemiluminescence substrate (West Dura ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primary antibodies were diluted in antibody diluent (Agilent; #S3022) and incubated with sections for 16 hours at 4 °C ...
-
bioRxiv - Immunology 2023Quote: ... antibodies were diluted in Background Reducing Antibody Diluent (Agilent) and subsequently incubated with an anti-rabbit HRP polymer (Leica ...
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies diluted in antibody diluent (S080983-2, Dako) were applied on sections for overnight at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... Primary Antibodies: anti-human CD41 antibody (Agilent, F708801-2) and alpha tubulin antibody (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2024Quote: ... Primary antibody staining in Background-Reducing Antibody Diluent (Agilent) with appropriate serum overnight at 4°C in a humid chamber ...