Labshake search
Citations for Agilent :
3401 - 3450 of 4099 citations for 7 Bromo 1 2 3 4 tetrahydronaphthalen 1 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... Scanning of microarrays was performed with 3 μm resolution (8×60K) using a G2565CA high-resolution laser microarray scanner (Agilent Technologies). Microarray image data were processed with the Image Analysis/Feature Extraction software G2567AA v ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples were subsequently diluted to adjust the HNO3 concentration to 3 % and ICP-MS was performed with a Hewlett-Packard 4500 ICP mass spectrometer (Agilent Technologies) connected to a CETACASX-500 auto-sampler for sample injection ...
-
bioRxiv - Neuroscience 2021Quote: ... Retinoid analyses were performed using normal phase Zorbax Sil (5 mm, 4.6 3 150mm) column (Agilent Technologies, Santa Clara, CA, USA). The retinoids were eluted by step-wise gradient starting with 0.5% ethyl acetate in hexane over 15 min ...
-
bioRxiv - Bioengineering 2022Quote: ... Two-channel 54.8 μm z-stack images were taken every 3 hours for 45 hours after co-culture was initiated using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Neuroscience 2022Quote: ... samples were injected into a C18 reverse phase column (Atlantis T3, 2.1 × 150 mm, 3 μm; Waters) using HPLC (Agilent 1290 LC) at a flow rate of 0.15□ml/min with 5 mM ammonium formate for mobile phase A and 100% methanol for mobile phase B ...
-
bioRxiv - Bioengineering 2024Quote: ... two-channel 100 µm z-stack images were taken every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantitative PCR was performed in technical triplicates from at least 3 independent biological samples using the SYBR green Brilliant II fast kit (Agilent Technologies) on an Mx3005p apparatus (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Bioengineering 2023Quote: ... at 40°C with an InfinityLab Poroshell 2.7 µM EC-C18 pre- column (3 x 5 mm; Agilent Technologies, Waldbronn, Germany) was used ...
-
bioRxiv - Biochemistry 2023Quote: ... (3) RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA).
-
bioRxiv - Bioengineering 2023Quote: ... PHA was extracted from lyophilized sludge using acidified methanol (3% sulfuric acid) containing chloroform and analyzed using a gas chromatography-mass spectrometry (Agilent, USA). Glycogen in sludge was extracted in a similar way but using 0.9M HCl and analyzed using a liquid chromatography-mass spectrometer (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA was cross-linked by exposing the living cells twice to 4,5′,8-trimethylpsoralen at a final concentration of 10 μg/mL followed by 3’ irradiation pulses with UV 365-nm monochromatic light (UV Stratalinker 1800, Agilent Technologies). The cells were then washed repeatedly with cold PBS and lysed with a cell lysis buffer (1.28M sucrose ...
-
bioRxiv - Biophysics 2023Quote: ... The monodisperse sample solutions of proteins were injected onto a size exclusion column (David and Perez 2009) (SEC-3, 150 Å; Agilent) using an Agilent HPLC system and eluted into the capillary cell at a flow rate of 0.3 ml min-1 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The slides were then treated with 3% hydrogen peroxide for 10 min and then blocked with Serum-Free Protein Block (Dako, X0909) for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... The pooled library was quality checked on an Agilent TapeStation System by mixing 3 µL D1000 Sample Buffer (Agilent 5190-6502) with 1 µL pooled library and running in D1000 ScreenTape (Agilent 5067-5582) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and absorbance was measured at 562 nanometers using the Bio-Tek Cytation 3 Multi-Mode Reader (Agilent, Santa Clara, CA, USA). The proteins were run on a 10% SDS-polyacrylamide gel ...
-
bioRxiv - Physiology 2023Quote: ... The metabolic function of activated CD4+ T cells cultured for 3 days in vitro was analyzed by measuring the extracellular acidification rate (ECAR) using an XFe96 extracellular flux analyzer (Seahorse Bioscience). The cells were kept in XF media (Seahorse Bioscience ...
-
bioRxiv - Plant Biology 2024Quote: ... The samples were homogenized and the supernatant was loaded onto a Bond Elut C18 cartridge (100 mg, 3 ml; Agilent Technologies) and eluted with 80% (v/v ...
-
bioRxiv - Cancer Biology 2024Quote: ... Supernatants were loaded into pre-conditioned Phenomenex Strata XL-100 60 mg/3 ml cartridges (Torrance, CA) and passed through it using positive pressure manifold (Agilent Technologies). Flow through was collected subsequently and 100 µL of filtrate was mixed with 100 µL of water for the LC-MS/MS system ...
-
bioRxiv - Microbiology 2024Quote: ... such as the uncut PT oligos and the four 3-mer release oligos (CCA, CCC, CCG, and CCT) using an HPLC system (Agilent 1290) as outlined below ...
-
bioRxiv - Neuroscience 2021Quote: ... the sections were incubated for 90 minutes in a biotin conjugated secondary antibody (a goat anti-rabbit, a goat anti-mouse or a swine anti-rabbit as appropriate; Dako; diluted 1:500) and for 1h in a peroxidase conjugated extravidin (Sigma ...
-
bioRxiv - Immunology 2020Quote: ... Purified cDNA was subjected to quality control using 1 µl of cDNA on an Agilent 2100 BioAnalyser (Agilent Technologies, Santa Clara, CA, USA) using the Agilent High Sensitivity DNA kit ...
-
bioRxiv - Molecular Biology 2019Quote: ... concentration and purity were evaluated on an Agilent RNA6000 Nano Chip in Reagent Port 1 of the Bioanalyzer Agilent 2100 (Agilent Technologies, CA, USA). Sequencing of the libraries was done on the Illumina HiSeq 4000 platform by BGI Co. ...
-
bioRxiv - Bioengineering 2019Quote: ... The following primary antibodies were used for immunocytochemistry experiments: rabbit anti-glial fibrillary acidic protein (GFAP) (DAKO, 1:100, Z-0334, Lot #2002332), mouse anti-vascular endothelial (VE)-cadherin (Abcam ...
-
bioRxiv - Neuroscience 2019Quote: ... and rabbit anti-S100 calcium-binding protein B β-subunit (S100-β) polyclonal antibody (Agilent Dako, Santa Clara, CA, USA Z0311, 1:400). Following washing ...
-
bioRxiv - Neuroscience 2020Quote: ... Fragment size was determined by loading 1 ng/μl cleaned up PCR product on the Fragment Analyzer System (Agilent Technologies, Santa Clara, USA) using the qualitative DNA Kit dsDNA Reagent 35-5000bp (Cat No ...
-
bioRxiv - Microbiology 2020Quote: ... followed by incubation with 50 µl/well of HRP-conjugated rabbit anti-mouse total IgG (1:1,000 in ELISA dilution buffer; P0260, Dako Agilent, Santa Clara, CA, USA), goat-anti-mouse IgG1 (1:8,000 in ELISA dilution buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... The recombinant transfer vector was linearized by PmeI and transformed into electro-competent E.coli strain BJ5183-AD-1 (Stratagene, Cat. No. 200157-11) for in vivo recombination with pAdEasy vector ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Blots were washed clear of unbound antibody in TBS-T before addition of anti-rabbit-HRP secondary antibody (1:1000 in 5% milk/TBS-T; Agilent Technologies, CA, U.S.A.) for 1 hr at RT ...
-
bioRxiv - Biochemistry 2022Quote: ... with HistoVT One (L6F9587, Nacalai Tesque) and stained with the following primary antibodies: anti-insulin antibody (A0564, 1:400; Dako, Santa Clara, CA), anti-glucagon antibody (ab92517 ...
-
bioRxiv - Neuroscience 2020Quote: ... by co-transfecting pAAV-GFP or pAAV-GFP-Zdhhc14sh#1 with pAAV2 (pACG2)-RC triple mutant (Y444, 500, 730F) (Petrs-Silva et al., 2016) and pHelper (Stratagene, La Jolla, California) plasmids ...
-
bioRxiv - Plant Biology 2021Quote: ... RNA quality was assessed on 1% agarose gels and with the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). For each sample ...
-
bioRxiv - Plant Biology 2021Quote: ... The genomic SPL7 (AT5G18830.1) coding region (translational start to stop codon) was PCR-amplified and cloned into the pBluescript SK+ vector (Stratagene/Agilent Technologies, Waldbronn, Germany) which was used a PCR template for site-directed mutagenesis (A279T ...
-
bioRxiv - Cell Biology 2022Quote: ... Medium was changed 1-hour before the start of readout into 180 μL serum-free assay medium (Agilent Seahorse XF DMEM; 103575-100) supplemented with 4mM L-glutamine (Corning ...
-
bioRxiv - Pathology 2020Quote: ... Cambridge, MA), CD68 (LV n=25, IVS n= 26, RV n=22) for macrophages (1:800, clone KP1, Dako/Agilent, Santa Clara, CA), and CD163 (LV n=26 ...
-
bioRxiv - Pathology 2020Quote: ... followed by repeating all steps from antigen retrieval through TSA using an antibody against CK7 (1:200, mouse; Dako cat. no. MS-1352) and the FITC fluorophore (Perkin Elmer cat ...
-
bioRxiv - Plant Biology 2019Quote: ... and gene-specific primers (Supplementary Table 1) to a final volume of 20 μl in clear 96-well plates with clear plastic lids (Agilent Technologies, Waldbronn, Germany). QRT-PCR assays were performed using an AriaMx Real-Time PCR system (G8830A instrument ...
-
bioRxiv - Physiology 2021Quote: ... Antibodies bound to PCPE-1 were then detected by incubation with a HRP-conjugated rabbit anti-goat antibody (P0449; Dako; 50 ng/ml). After washing ...
-
bioRxiv - Systems Biology 2019Quote: ... fluorescent chemistry and 1 ng was used to obtain RNA Integrity Number (RIN) using the Bioanalyzer RNA 6000 Pico kit (Agilent Technologies, 5067-1513). Lowest RIN was 9.5 ...
-
bioRxiv - Microbiology 2019Quote: ... The reaction products for the total RNA of the human cell line KMM-1 were analysed by microfluidics-based automated electrophoresis with the Agilent 2100 Bioanalyzer (Agilent Technologies, CA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2020Quote: The pooled library was diluted to ~1 ng/uL and run on a Bioanalyzer High Sensitivity DNA chip (Agilent, Santa Clara, CA, USA) to check library purity and to estimate the expected ratio of host to microbial amplicons in the sample.
-
bioRxiv - Immunology 2020Quote: The OCR and ECAR of THP-1 macrophages were determined using the Seahorse XFe24 Extracellular Flux Analyzer (Agilent Technologies, Santa Clara, CA, USA). Cells were seeded at 8 × 104 per well ...
-
bioRxiv - Genomics 2020Quote: ... to enrich for fragments between 300-700 bp and 1 ul was used for quantitation and size analysis on an Agilent Bioanalyzer High Sensitivity D1000 chip (Agilent cat. 5067-5584). ATAC-seq libraries were subjected to 50 bp single-end sequencing on an Illumina Hi-Seq 4000 instrument ...
-
bioRxiv - Immunology 2022Quote: ... Quality control of the libraries to ensure no adapter dimers were present was carried out by examining 1ul of a 1:5 dilution on a High Sensitivity DNA chip (Agilent Technologies: 5067-4626) on an Agilent 2100 Bioanalyzer ...
-
bioRxiv - Pathology 2022Quote: ... and a monoclonal antibody directed against the alpha isoform of smooth muscle actin at a working dilution of 1/100 (a-SMA, clone 1A4, n M0851; Dako, Denmark A/S). Alligator skeletal muscle was used as positive control for anti-desmin antibody (Supplemental figure 3A) ...
-
bioRxiv - Neuroscience 2022Quote: ... and incubated overnight on a shaker at room temperature in fresh blocking solution with polyclonal rabbit anti-GFAP (1:1000, Dako, Santa Clara, CA). The following day tissue was washed in PBST and incubated for 2.5h at room temperature with Alexa Fluor 488 donkey anti-rabbit secondary (1:500 ...
-
bioRxiv - Cell Biology 2022Quote: ... OCI-LY-1 cells (5 × 105 cells/ml) were pretreated for 1 hour in Seahorse Seahorse XF base medium supplemented with glutamine (103334-100, Agilent Technologies, Heverlee, Belgium) in a CO2-free incubator ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cells were then incubated at 37°C in a non-CO2 incubator for 1 hour and subsequently loaded into the Seahorse XFe96 Analyzer (Agilent Technologies, Seahorse Bioscience) when prompted ...
-
bioRxiv - Microbiology 2023Quote: ... The quality of the DNA was checked on a Nanodrop to ensure that the OD600 260/230 and 260/280 ratios were >1.8 and the DNA length distribution was checked using a Femto Pulse (Agilent Technologies; Supplementary Figure 1).
-
bioRxiv - Microbiology 2023Quote: ... tissues were incubated with proteinase K diluted 1:10 in 1X TBS (Fisher Scientific, Cat. #BP24711; and PNA ISH kit, Agilent Dako, Cat. #K5201) for 10 min at RT in a humidity chamber ...