Labshake search
Citations for Agilent :
3351 - 3400 of 8895 citations for Mouse Stress Induced Phosphoprotein 1 STIP1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... Quality of RNA was assessed using 2100 Bioanalyzer RNA 6000 Pico kit (Agilent).
-
bioRxiv - Genomics 2020Quote: ... and on a Bioanalyzer 2100 with a RNA 6000 Pico Assay kit (Agilent). cDNA were constructed using the SMARTer-Seq v4 Ultra low Input RNA kit (ClonTech) ...
-
bioRxiv - Neuroscience 2019Quote: Mutations to plasmids were created with Quikchange II site-directed mutagenesis kit (Agilent). Sequences for primers used in mutations are found in table S1.
-
bioRxiv - Molecular Biology 2019Quote: ... The libraries were amplified 7x using Herculase II Fusion Polymerase kit (Agilent: 600677).
-
bioRxiv - Immunology 2020Quote: ... and quality controlled using RNA 6000 Nano kit on a 2100 Bioanalyser (Agilent). Only samples with RIN values above 8 were sequenced ...
-
bioRxiv - Developmental Biology 2019Quote: ... and analyzed for integrity using RNA 6000 Pico Kit for 2100 Bioanalyzer (Agilent). mRNA was purified from total RNA using NEBNext Poly(A ...
-
bioRxiv - Genetics 2019Quote: ... and RNA 6000 Nano Kit on the Agilent Bioanalyzer 2100 system (Agilent Technologies), respectively ...
-
bioRxiv - Microbiology 2019Quote: ... and RRD87N were created using the QuikChange XLII Site-Directed Mutagenesis Kit (Agilent) with plasmid pGEMlpg0277 serving as a template and using primers sets E396K-F/E396K-R ...
-
bioRxiv - Developmental Biology 2020Quote: ... and a Nano 6,000 Assay Kit of the Bioanalyzer 2,100 system (Agilent Technologies), respectively ...
-
bioRxiv - Molecular Biology 2019Quote: ... The signal was detected using the rabbit horseradish peroxidase EnVision kit (DAKOCytomation, K4003). This secondary antibody kit was directly applied to the slides without dilution ...
-
bioRxiv - Immunology 2019Quote: ... and profiled using Bioanalyzer High Sensitivity DNA kit (Agilent Technologies, Santa Clara, CA) and quantified with Kapa Library Quantification Kit (Kapa Biosystems ...
-
bioRxiv - Molecular Biology 2019Quote: ... Quality of RNA was assessed using 2100 Bioanalyzer RNA 6000 Pico kit (Agilent). Next ...
-
bioRxiv - Cancer Biology 2019Quote: ... Quantitative PCR was performed by using QuantiNova kit on Mx3500P PCR machine (Stratagene). The following oligonucleotide primers were used to detect target gene expression ...
-
bioRxiv - Genomics 2019Quote: ... DNA was quantified using the Qubit DNA HS assay kit and Bioanalyzer (Agilent) using the DNA High Sensitivity kit ...
-
Structural determinants of protocadherin-15 elasticity and function in inner-ear mechanotransductionbioRxiv - Biophysics 2019Quote: ... All engineered missense mutations were generated using the QuikChange Lightning mutagenesis kit (Agilent). Insertions of a BAP sequence (p.GLNDIFEAQKIEWHE ...
-
bioRxiv - Molecular Biology 2021Quote: ... RR/EE were made with use of QuikChange Site-Directed Mutagenesis Kit (Agilent), according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... and size distribution was measured with the Bioanalyzer High Sensitivity DNA Kit (Agilent). DNA libraries resulting from MNase digestion and ChIP were sequenced on an Illumina HiSeq2500 in high output run mode ...
-
bioRxiv - Cell Biology 2020Quote: ... PfuTurbo DNA polymerase and QuikChange Site-Directed Mutagenesis Kit were obtained from Agilent Technologies (Santa Clara ...
-
bioRxiv - Immunology 2021Quote: ... CENSER and proximal deletion constructs were done using the QuikChange mutagenesis kit (Agilent). Deletions were verified by gel electrophoresis.
-
bioRxiv - Synthetic Biology 2021Quote: ... Probes were labeled with the prime-it II random primer labelling kit (Agilent) using α32P -dCTP ...
-
bioRxiv - Cancer Biology 2021Quote: ... VRK2K168E was generated through the QuickChange II site-directed mutagenesis kit (Agilent Technologies) using the primer ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA synthesis was performed using Accuscript Hi Fidelity First Strand Synthesis kit (Agilent). The amount of RNA entered into the reaction was normalised between samples ...
-
bioRxiv - Biophysics 2020Quote: ... pEGFPC1-epsin 1R114A was prepared by QuikChange II Site-directed mutagenesis kit (Agilent) using the pEGFPC1-epsin 1 as a template ...
-
bioRxiv - Cancer Biology 2021Quote: ... Exome capture was performed with the SureSelect Human All Exon v6 kit (Agilent) and sequenced on the Illumina HiSeq platform ...
-
bioRxiv - Cancer Biology 2021Quote: ... and library size was determined using the Bioanalyser High Sensitivity DNA kit (Agilent). Finally ...
-
bioRxiv - Biochemistry 2020Quote: ... C777S and C795S mutations were introduced using the QuikChange Lightning mutagenesis kit (Agilent) using oligonucleotide primers C777S-D ...
-
bioRxiv - Bioengineering 2021Quote: Agilent PEG calibration kit (PEG molecular weights up to 300,000 MW, Agilent Technologies) were used for calibration ...
-
bioRxiv - Cell Biology 2021Quote: ... QuantiTect primer assays and Brilliant III SYBR Green QRT-PCR Kit (Agilent Technologies) in a ViiA 7 Real-Time PCR System (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... quality checked using Agilent High Sensitivity DNA Kit (Agilent, Santa Carla, CA, USA) and Quant-iT PicoGreen dsDNA assay kit ...
-
bioRxiv - Plant Biology 2020Quote: ... Mutagenesis was performed using the QuikChange II Site-directed mutagenesis kit (Agilent, USA). Web-based Quik Change Primer Design tool (www.agilent.com/genomics/qcpd ...
-
bioRxiv - Microbiology 2020Quote: ... DNA library sizes were then analyzed using a BioAnalyzer DNA 1000 kit (Agilent) and the DNA concentration was quantified using Qubit High Sensitivity DNA kit (Thermo Fisher ...
-
bioRxiv - Microbiology 2020Quote: ... and cartridge electrophoresis on a 2100 Bioanalyzer (Agilent RNA Nano kit 6000, Agilent Technology ...
-
bioRxiv - Plant Biology 2021Quote: ... with the Quick Change Lightning Site-Directed Mutagenesis Kit (Agilent Technologies, Cat #210518). Similarly ...
-
bioRxiv - Systems Biology 2021Quote: ... RNA quality was assessed using a Pico RNA kit for the BioAnalyzer (Agilent). We were able to extract good quality RNA from all but one sample (male head day2_20:00_c) ...
-
bioRxiv - Neuroscience 2020Quote: ... the Quick Change Lighting MultiSite-directed Mutagenesis kit (Agilent Technologies, Les Ulis, France) was used and the primers were as follows ...
-
bioRxiv - Pathology 2021Quote: ... After treatment with an enhancing reagent (EnVision Kit, DAKO Japan, Inc., Tokyo, Japan), immunohistologic localization of α-SMA was visualized by 3,3’-diaminobenzidine ...
-
bioRxiv - Plant Biology 2021Quote: ... Chimeric PCR products were subcloned before sequencing using StrataClone PCR cloning kits (Agilent).
-
bioRxiv - Microbiology 2021Quote: ... Mutant LGMN genes were generated using site-directed mutagenesis (QuikChange II kit; Agilent). Genes were amplified by PCR and inserted into the lentiviral vector pLVX-Hhi3 (gift from Sanford M ...
-
bioRxiv - Microbiology 2021Quote: ... Quality was checked using a 2100 Bioanalyzer with High Sensitivity DNA kit (Agilent). Sequencing was performed in paired-end mode with a SP flow cell (2 x 50 cycles ...
-
bioRxiv - Cancer Biology 2020Quote: ... and library size was determined using the Bioanalyser High Sensitivity DNA kit (Agilent). Libraries were diluted to 2nM and sequenced using the Illumina HiSeq 4000 platform the Genomics Facility at ICL to obtain paired-end 75bp reads.
-
bioRxiv - Cancer Biology 2020Quote: ... S838A/T841A substituted plasmid was made with QuikChange Site-directed mutagenesis kit (Agilent), following manufacturer’s recommendations and mutagenic primers TTAGTATCAATTGGTGAAGCATTCGGGGCTTCT GAGAAGTTCCAGAAA and TTTCTGGAACTTCTCAGAAGCCCCGAATGCTT CACCAATTGATACTAA ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA quality was assessed using the Agilent RNA 6000 Pico Kit (Agilent Technologies). cDNA was generated using Ovation RNA-seq System V2 (Tecan ...
-
bioRxiv - Cell Biology 2021Quote: ... site directed mutagenesis was performed with QuickChange Lightning Site-Directed Mutagenesis Kit (Agilent) and primers CEP78 mut_F and CEP78 mut_R (see Key Resources Table) ...
-
bioRxiv - Cancer Biology 2021Quote: Ser155 of MEOX2 was mutated using using QuikChange Site-Directed Mutagenesis Kit (Agilent). The mutagenic primer was CCGCCAGGCACTGGCACCTGCGGAGGC ...
-
bioRxiv - Cell Biology 2021Quote: ... Telomere FISH was conducted using the Telomere PNA FISH Kit/Cy3 (Dako, K5326) according to the protocol provided by the supplier.
-
bioRxiv - Cancer Biology 2021Quote: Metabolism profiling was carried out by Agilent Seahorse XFp Cell Energy Phenotype test kit on a Seahorse XFp analyser (Agilent). Protocols were carried out according to manufacturer guidelines and data was analysed using Agilent Seahorse Wave desktop V2.5 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and analyzed on a bioanalyzer using the Agilent RNA 6000 Pico Kit (Agilent). 2.5-10 ng of RNA per sample was used as input for library preparation.
-
bioRxiv - Molecular Biology 2022Quote: ... equipped with a SYBR® Premix Ex Taq™ kit (Agilent Aria (v1.5) Software ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA integrity was assessed using Agilent RNA 6000 Nano Kit (Agilent Technologies, USA). RNA samples with RIN score ≥ 9 were used for the preparation of cDNA libraries.
-
bioRxiv - Immunology 2022Quote: ... Quality control was performed with Agilent Bioanalyzer High Sensitivity DNA kit (Agilent Technologies). Libraries were then purified ...