Labshake search
Citations for Agilent :
3601 - 3650 of 8895 citations for Mouse Stress Induced Phosphoprotein 1 STIP1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: Isolated RNA was examined on a Bioanalyzer with the RNA Nano kit (Agilent). RNA-Seq library preparation was carried out with 1 µg of RNA from all samples that passed an RNA Integrity Number (RIN ...
-
bioRxiv - Genomics 2024Quote: ... DNA quality was assessed with the TapeStation genomic DNA kit (Agilent, #5067-5365). Samples too diluted to be compatible with the kit were first concentrated using AMPure Beads (Beckman Coulter ...
-
bioRxiv - Plant Biology 2024Quote: ... or Femto Pulse Genomic DNA 165 kb Kit (Agilent cat# FP-1002-0275). For samples sourced from “OCBD” (Supplemental Table 1 ...
-
bioRxiv - Neuroscience 2024Quote: ... and integrity (Agilent RNA 6000 Pico kit; Agilent Technologies, Santa Clara, CA, USA). The average RNA integrity number (RIN ...
-
bioRxiv - Microbiology 2024Quote: ... and H1N1pdm09 were generated using the QuikChange II site-directed mutagenesis kit (Agilent). The PR8 pHW-PA(ΔX ...
-
bioRxiv - Biophysics 2024Quote: Protein variants were constructed using a QuikChange site-directed mutagenesis kit (Agilent, USA). The primer that introduced desired nucleotide changes was designed using QuikChange online tool (Table S3C ...
-
bioRxiv - Biochemistry 2024Quote: ... mutagenesis was performed using the QuickChange® Lightning Site-Directed Mutagenesis Kit (Agilent) using the forward primer 5’ CAAACAGATTGTGAGTATAACTACTGGGGCCAG 3’ and the reverse primer 5’ AGTTATACTCACAATCTGTTTGTGGACTCCAACCCG 3’ ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA was synthetized using the Affinity Script Multiple Temperature cDNA Synthesis kit (Agilent), following manufacturer’s instructions with oligo-dT primers ...
-
bioRxiv - Neuroscience 2024Quote: ... and High Sensitivity NGS fragment analysis kit on the Fragment Analyzer (Agilent Technologies). The amount of cDNA was standardized across samples and the libraries were sequenced on Illumina NextSeq500 sequencing machine with 75-bp single-end reads ...
-
bioRxiv - Developmental Biology 2024Quote: ... following the instructions of the manufacturer (Agilent RNA 6000 Pico Kit 5067–1513). Amplification of the extracted RNA (700 pg ...
-
bioRxiv - Molecular Biology 2024Quote: Site-directed mutagenesis was performed using QuikChange II Site-Directed Mutagenesis Kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... Total RNA was quantified on an Agilent BioAnalyzer via the Pico kit (Agilent). SMART-Seq HT Kit (Takara ...
-
bioRxiv - Cell Biology 2020Quote: ... diluted 1:33 in BSA 1% in PBS without Ca2+ and Mg2+for 1h at RT or with negative isotype control mouse IgG2a (cat. X0943 - Agilent Technologies, Santa Clara, CA, USA). Then ...
-
bioRxiv - Immunology 2021Quote: ... a monoclonal mouse antibody against the intracellular tail of human HLA-DR α chain was used (Clone TAL.1B5, # M0746, Agilent, Santa Clara, CA, USA). Detection of MHC-I on the surface of cells was performed using a monoclonal mouse antibody against devil beta-2-microglobulin (B2M ...
-
bioRxiv - Immunology 2022Quote: ... then incubated in 5 μg/ml primary antibody in incubation buffer (anti-Mala s 1 mouse monoclonal IgG1 antibody (9G9) from Karolinska Institute (Zagari A et al, 1994, Schmidt et al, 1997) or mouse monoclonal IgG1 antibody (Agilent Dako X093101-2; Santa Clara, USA) as an isotype control for 90 min ...
-
bioRxiv - Pathology 2024Quote: Consecutive 4-μm slices of human-aspirated thrombi were immunohistochemically stained using antibodies against glycophorin A (erythrocyte marker, mouse monoclonal antibody, clone JC159; Dako/Agilent, Santa Clara, CA, USA), fibrin (mouse monoclonal antibody ...
-
bioRxiv - Cell Biology 2020Quote: ... The cells were incubated with anti-tubulin (Thermo PA1-41331; dilution 1:250) and K9JA (Dako A0024; dilution 1:500) antibody ...
-
bioRxiv - Immunology 2019Quote: ... incubated overnight at 4 °C with polyclonal guinea pig anti-insulin antibody (1:100 in 1% BSA in DPBS, DAKO) followed by 1 h room temperature incubation either with Alexa Fluor® 488 AffiniPure donkey anti-guinea pig or with DyLight™ 594 AffiniPure donkey anti-guinea pig secondary antibody (1:100 in 1% BSA in DPBS ...
-
bioRxiv - Neuroscience 2020Quote: ... Briefly, Iba1 (Wako, 019-19741, 1:2,000) was used to visualize microglia/macrophages and anti-GFAP (Dako, Z0334, 1:15,000) was used to visualize astrocytes ...
-
bioRxiv - Cancer Biology 2020Quote: ... trifluoroacetamide containing 1% trimethylchlorosilane (Pierce, 20 μl, 1 hour, 37 °C) and analysed by GC-MS using a VF5 capillary column (Agilent, 30 m ...
-
bioRxiv - Neuroscience 2020Quote: ... to prevent non-specific binding was followed by a 1-hour incubation in primary antibody (pERK; 1:800) in Antibody Diluent (S0809, Agilent DAKO). Following removal of excess primary antibody with wash buffer ...
-
bioRxiv - Microbiology 2021Quote: ... Nucleus staining was performed with DAPI 1 µg/mL for 1 min and coverslips were mounted on slides with fluorescent mounting medium (Dako). Cells were observed under a SP8 confocal laser-scanning microscope equipped with an HCP PL APO 100x/1.44 Oil CORR CS immersion objective (Leica) ...
-
bioRxiv - Neuroscience 2020Quote: ... Immunohistochemistry with polyclonal antibody 1175 (1:1,000) directed against α-synuclein phosphorylated at Ser129 or anti-ubiquitin (DAKO, 1:10,000) were performed as described previously (Masuda-Suzukake et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... diluted 1:100 or CD3 antibodies (Spring biosciences, Clone SP7, ref. M3070) diluted 1:200 in Antibody diluent solution (DakoCytomation). After several washes in PBS ...
-
bioRxiv - Biophysics 2019Quote: ... anti-surfactant C protein antibody to target membrane antigen secreted from airway type 2 epithelial cells in alveoli or ii) anti-thyroid transcription factor-1 (TTF-1) antibody (Dako Agilent Products ...
-
bioRxiv - Biophysics 2019Quote: ... anti-surfactant C protein antibody to target membrane antigen secreted from airway type 2 epithelial cells in alveoli or ii) anti-thyroid transcription factor-1 (TTF-1) antibody (Dako Agilent Products ...
-
bioRxiv - Molecular Biology 2020Quote: ... Goat polyclonal anti-mouse (p0447, bach number 20051789. 1/3000) and anti-rabbit (p0448, batch number 20017525. 1/5000) antibodies were purchased from Dako.
-
bioRxiv - Biophysics 2020Quote: His-tagged CrSAS-6[NL] spanning amino acids 1-503 of the protein (see Supplementary Fig. 1a)1 was expressed in the Escherichia coli strain BL21(DE3) (Stratagene). Bacteria were grown at 37 °C in lysogeny broth (LB ...
-
bioRxiv - Cancer Biology 2020Quote: ... sections were blocked in DAB substrate-chromogen solution containing 1 ml substrate buffer and 1 drop of DAB chromogen (DAKO) for 10 minutes followed by rising with dH2O for 5 minutes ...
-
bioRxiv - Biophysics 2019Quote: ... construct by deleting 14aa from near the C-terminus of PRC1 isoform 1 (aa:1-620) using Quikchange mutagenesis (Agilent). The PRC1 isoform 2 gene was then in a pET-DUET plasmid containing an N-terminal histidine tag followed by a Tobacco Etch Virus (TEV ...
-
bioRxiv - Neuroscience 2022Quote: ... brain sections were blocked with 5% normal donkey serum for 1 h at room temperature and incubated with primary antibodies (rabbit anti-GFAP 1:200, Dako; goat anti-Iba1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... at 200 µl min-1 and the digested peptides were captured on a 2 mm x 1 cm C8 trap column (Agilent) and desalted ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-Pu.1 (1:200; 2258, Cell Signalling), hamster anti-CD3 (1:500; MCA2690, AbD Serotec) or rabbit anti-GFAP (1:2400, Z0334, Dako) diluted in the blocking solution overnight at 4°C plus one additional hour at room temperature (RT) ...
-
bioRxiv - Physiology 2024Quote: ... tissues were incubated with primary antibody over night at 4°C (guinea pig anti-insulin at 1:4, diluted in 1% goat serum/PBS, Agilent). This was followed by 1-hour incubation with fluorophore-conjugated secondary antibodies (Cy3-anti-guinea pig ...
-
bioRxiv - Immunology 2024Quote: ... The membrane was washed three times in block buffer followed by a 1 h incubation with anti-goat/-rabbit HRP-conjugated secondary antibodies (1:5000, Agilent Dako) at RT ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed three times for 20 min in TBS-T before incubation with horseradish peroxidase (HRP)-labeled secondary antibody in TBS-T at RT for 1 hour: Goat anti-Rabbit HRP (1:10,000, Agilent P0448), Rabbit anti-Goat HRP (1:10,000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 0.1% w/v Tween-20 for 5 min and incubated with the following secondary antibodies for 1 hour at room temperature: swine anti-rabbit (1:200, catalog no. P0339, Dako) or anti-mouse horseradish peroxidase (HRP)-conjugated immunoglobulins (1:200 ...
-
bioRxiv - Genomics 2023Quote: ... CD20, Ventana Roche L26, prediluted; CD3, Leica LN10, 1:500; CD68, DAKO A/S PG-M1, 1:50; CD138, DAKO A/S ...
-
bioRxiv - Molecular Biology 2023Quote: ... which was amplified using Herculase II Fusion DNA polymerase in 100-µl reaction mixtures (1× Herculase II reaction buffer, 1 mM dNTPs, 200 pM Agilent library ...
-
bioRxiv - Cancer Biology 2023Quote: ... The organic samples were resuspended in 200 µL of 2:1:1 isopropyl alcohol:acetonitrile:water and transferred to amber glass mass spectrometry vials (Agilent 5182-0716) containing a glass insert ...
-
bioRxiv - Cancer Biology 2023Quote: ... The organic samples were resuspended in 35x the packed cell volume using 2:1:1 isopropyl alcohol:acetonitrile:water and transferred to amber glass mass spectrometry vials (Agilent, 5182-0716) containing a glass insert ...
-
bioRxiv - Neuroscience 2023Quote: ... free-floating brain slices were incubated in a solution of anti-Iba1 antibody (1:2000; Fuji film-Wako) or anti-GFAP antibody (1:10,000; Agilent-Dako) at 4°C overnight ...
-
bioRxiv - Pathology 2024Quote: ... the above IHC protocol was modified such that the anti-SARS-CoV-2 S primary antibody was at 1:1000 dilution (1 µg/mL) in background-reducing antibody diluent (Dako, S302283-2 ...
-
bioRxiv - Biochemistry 2020Quote: ... and secondary rabbit (Dako, P0448, 1/1000 dilution), mouse anti-IgG-HRP (Dako ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-PCNA antibody (1:1000, PC10, Dako). Following secondary antibodies (all 1:500 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 1 µl of PfuTurbo DNA polymerase (Agilent) for amplification in a final volume of 50 µl ...
-
bioRxiv - Developmental Biology 2021Quote: ... Primary antibodies used were: Insulin (DAKO, 1:400), C-peptide (Abcam ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 1 μM Rotenone/Antimycin A (Agilent, 103015-100) were added at indicated timepoints ...
-
bioRxiv - Neuroscience 2021Quote: ... GFAP (1:1000, Agilent Dako, Glostrup, Denmark, Z0334), Neuropeptide Y (1:500 ...
-
bioRxiv - Neuroscience 2021Quote: ... GFAP (1:1000, Agilent Dako, Glostrup, Denmark, Z0334), Neuropeptide Y (1:500 ...