Labshake search
Citations for Agilent :
3101 - 3150 of 3795 citations for Mouse Chitinase 1 CHIT1 Protein since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... incubated in a 1:2000 dilution of peroxidase-conjugated anti-rabbit immunoglobulin (Dako, Santa Clara, California, USA) in PBS with 3% skimmed milk and 0.05% Tween for 45 min. ...
-
bioRxiv - Neuroscience 2022Quote: ... They were then incubated overnight at +4 °C with the 6F3D anti-Aβ antibody (Dako, 1/200), polyclonal anti-tau antibody (Dako ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Both systems contained a DB-VRX capillary column (20 m, 0.18 mm ID, 1 µm film; Agilent) and a 100 µL gastight syringe (G4513-80222 ...
-
bioRxiv - Genomics 2022Quote: ... into 1 mL 96 well plates and sealed with a silicone plate mat (Agilent, Santa Clara, CA). Aliquots of 12 samples from each row were combined into pools ...
-
bioRxiv - Neuroscience 2020Quote: ... 2% BSA in 0.1% PBS-Tx and stained with rabbit anti-human tau antibodies (1:1000; Dako) or mouse anti-phospho tau PHF-1 (1:1000 – thermofisher) ...
-
bioRxiv - Plant Biology 2021Quote: ... 1 μl sample was injected into a gas chromatograph coupled to a mass spectrometer (GC-MS; Agilent) on a HP-5MS column (Agilent) ...
-
bioRxiv - Immunology 2020Quote: ... consistently identified GFAP peptides while minimizing nonspecific off-target peptide identification (Agilent Z033429-2, 1:200 dilution). Each peptide was required to have a minimum of 1 RPK as well as a FC > 10 ...
-
REV-ERBα mediates complement expression and circadian regulation of microglial synaptic phagocytosisbioRxiv - Neuroscience 2020Quote: The following primary antibodies were used (with dilution): Gfap (Rabbit polyclonal, 1:2500, Dako/Agilent Cat# Z0334), C3 (Rat monoclonal ...
-
REV-ERBα mediates complement expression and circadian regulation of microglial synaptic phagocytosisbioRxiv - Neuroscience 2020Quote: The following primary antibodies were used (with dilution): Gfap (Rabbit polyclonal, 1:2500, Dako/Agilent Cat# Z0334), C3 (Rat monoclonal ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 1 μg total RNA template per reaction was used using High Capacity cDNA Reverse Transcription Kit (Agilent). RNAase-free water (total 4.2 μl) ...
-
bioRxiv - Microbiology 2021Quote: ... and the average library size (Supplementary Table 1) was determined using the Agilent 2100 Bioanalyzer (Agilent Technologies). The library was diluted (to 6.5 pM ...
-
bioRxiv - Immunology 2022Quote: ... anti-human IgG was diluted 1:1000 in assay buffer and Cy3-rabbit antihuman IgG (Dako Cytomation) by incubation for 2 h at room temperature according to the manufacturer’ ss recommendations ...
-
bioRxiv - Physiology 2020Quote: ... Slides were blocked with 20% FCS in PBS and incubated overnight with 1/10 anti-insulin (Dako) and 1/500 anti-Ki67 (Abcam ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA integrity was assessed in 1% agarose gel electrophoresis or TapeStation RNA ScreenTape (Agilent Technology, CA, USA). During RNA isolation ...
-
bioRxiv - Immunology 2021Quote: ... A polyclonal rabbit anti-CD3 (#A0452, diluted 1:100 in TBS, Dako Agilent, Santa Clara, CA, USA) or rabbit anti-CD20 (#RB-9013-P1 ...
-
bioRxiv - Immunology 2021Quote: ... A polyclonal rabbit anti-CD3 (#A0452, diluted 1:100 in TBS, Dako Agilent, Santa Clara, CA, USA) or rabbit anti-CD20 (#RB-9013-P1 ...
-
bioRxiv - Physiology 2020Quote: ... Blots were incubated with anti-IαI rabbit polyclonal Dako antibody (1:8000; Agilent Technologies, Santa Clara, CA), followed by IRDye® 800CW donkey anti-rabbit secondary (1:15,000 ...
-
bioRxiv - Biochemistry 2021Quote: Primary antibodies used in this study were rabbit polyclonal anti-ubiquitin antibody (Dako, discontinued, 1:2000 dilution), monoclonal mouse anti-Flag M2 (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... The hybridized slides were washed using Gene Expression Wash Buffer 1 (Agilent Technologies, Part Number 5188-5325) and Gene Expression Wash Buffer 2 (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were acidified with 1% formic acid (FA) and purified using OMIX C18 Mini-Bed tips (Agilent) prior to LC-MS/MS analysis.
-
bioRxiv - Developmental Biology 2020Quote: ... The following primary antibodies and dilutions were used: guinea pig anti-Insulin (1:6, Dako, IR00261-2), mouse anti-Glucagon (1:500 ...
-
bioRxiv - Biophysics 2020Quote: ... The cHMM cDNA was cloned into the pShuttle-IRES-hrGFP-1 vector (Agilent Tech., Santa Clara, CA) and an AdcHMM-Flag virus was prepared and amplified for expression of cHMM protein in C2C12 cells [36] ...
-
bioRxiv - Immunology 2021Quote: ... or goat anti-rabbit IgG (250 ng ml−1, 2.5% BSA in PBST; Dako, (Dako, P044801-2) at room temperature for 1 h ...
-
bioRxiv - Immunology 2021Quote: ... or goat anti-rabbit IgG (250 ng ml−1, 2.5% BSA in PBST; Dako, (Dako, P044801-2) at room temperature for 1 h ...
-
bioRxiv - Immunology 2021Quote: ... sections were immunolabelled using a rabbit anti-MPO polyclonal affinity purified antibody (1:500; Dako Omnis, A0398) and incubated with Dako anti-rabbit HRP polymer (Agilent ...
-
bioRxiv - Neuroscience 2021Quote: ... Immunohistochemistry was performed after the hybridization using rabbit polyclonal antibodies against GFAP (1:250; GA524; Agilent Dako) overnight at RT ...
-
bioRxiv - Neuroscience 2021Quote: ... Immunohistochemistry was performed after the hybridization using rabbit polyclonal antibodies against GFAP (1:250; GA524; Agilent Dako) overnight at RT ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and their integrity was assessed via 1% agarose gel electrophoresis or Bioanalyzer RNA 6000 Nano kit (Agilent). Library quantification ...
-
bioRxiv - Cancer Biology 2022Quote: Full-length human Plk3 (1-646 aa; accession number NM_004073) cloned into a pCMV-Tag2A vector (Stratagene) to construct a Flag-tagged expression plasmid was described previously (Li et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... and β-amyloid analysis (pretreatment with formic acid, antibody 4G8, DAKO, M087201-2, 1:100, 30 minutes). Tau pathology was assessed using Braak criteria (Braak et al ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 uL In-Fusion reaction mix was transformed into commercial chemically competent Escherichia coli (XL10-Gold, Agilent). Colonies were manually picked into Lysogeny broth supplemented with 100 μg/mL ampicillin in a 96-well block the next day after transformation and incubated in a shaker (MaxQ 5000 ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 mL gas sample of head space was withdrawn and injected into the gas chromatography (Agilent 7890B) utilizing a gas-tight syringe to measure ethylene concentration ...
-
bioRxiv - Genomics 2024Quote: ... DNA length was assessed by running 1 μl on a genomic screentape on the TapeStation 4200 (Agilent). DNA concentration was assessed using the dsDNA BR assay on a Qubit fluorometer (ThermoFisher) ...
-
bioRxiv - Genetics 2023Quote: ... 1 μg RNA was used to synthesise cDNA using the Multi-temp cDNA Synthesis kit (Agilent, #200436). The final reaction volume was made up to 1ml with nuclease free water and used for RT-qPCR analysis.
-
bioRxiv - Pathology 2023Quote: ... USA) and fragmentation analyzed by 1% agarose gel electrophoresis and High Sensitivity Bioanalyzer 2100 assay (Agilent Technologies).
-
bioRxiv - Cell Biology 2023Quote: ... Primary anti-human von Willebrand factor (VWF) antibody (1:1000 dilution in PBS, LOT # 75601, Agilent Dako) was incubated overnight at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... then incubated overnight at 4°C with anti-total tau primary antibody solution (1: 5000, DAKO A0024). After 1 hour incubation at RT in the corresponding secondary antibody solution (donkey anti-rabbit 800) ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were immunoblotted with the following primary antibodies: polyclonal rabbit Anti-Human Tau (1:10 000, Dako) and monoclonal mouse Anti-Actin (1:25 000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Membranes were washed in TBST and probed with secondary antibodies: anti-rabbit HRP (Dako, P0448, 1:2000) for E-Cadherin and Vimentin ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary anti-human von Willebrand factor (VWF) antibody (1:1000 dilution in PBS, LOT # 75601, Agilent Dako) was incubated overnight at 4°C ...
-
bioRxiv - Genetics 2023Quote: ... We pooled 1 μL of each library and fragment size was assessed with Bioanalyzer 2100 (Agilent™) using the High sensitivity DNA kit (#5067-4626) ...
-
bioRxiv - Genetics 2023Quote: ... Blocking was performed for 1 hour in PBS supplemented with 10% normal goat serum (NGS) (Agilent, X0907). The cells were incubated overnight at 4°C with primary antibodies (Supplementary table 4 ...
-
bioRxiv - Immunology 2023Quote: 1 x 105 BMDMs were seeded in Agilent Seahorse XF24 Cell Culture Microplate (Agilent Technologies, 100777-004) and treated as required by experiments ...
-
bioRxiv - Immunology 2023Quote: ... Images were acquired (1-5 images per subject) using the Cytation 5 Cell Imaging MultiMode Reader (Agilent). Images were processed to quantify fluorescence intensity using Gen5 software package 3.08.
-
bioRxiv - Cancer Biology 2023Quote: ... or a High Sensitivity NGS Fragment Analysis Kit (1 bp - 6,000 bp) on a Fragment Analyzer (Agilent). Libraries were quantified by Qubit dsDNA HS Assay (Life Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... The membranes were further incubated with a goat anti-rabbit HRP-conjugated secondary antibody (1:2000, DAKO) for 1 h at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: ... The following primary antibodies were used in this study: rabbit anti-Tau (K9JA) (1:1000, #A0024, DAKO), chicken anti-MAP2 (1:2000 ...
-
bioRxiv - Microbiology 2024Quote: ... was performed in a 25 μL reaction mix comprising 1× TaqMan Brilliant II master mix (Agilent, UK), 0.05 pmol/μL forward primer (CCAACCGTGTGTTTCCTCCT) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 1-mm orbital shake in a BioTek Synergy H1 Multimode plate reader (Agilent Technologies, Inc., USA). Optical density at 600 nm (OD600 ...
-
bioRxiv - Neuroscience 2024Quote: ... The sections were subsequently incubated with primary antibody solution containing rabbit anti-GFAP [1:500] (DAKO, Z0334) in blocking solution for 24 hr at 4 °C ...