Labshake search
Citations for Agilent :
3101 - 3150 of 5977 citations for Human CD283 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... We used a Femto Pulse system with an Ultra Sensitivity RNA kit (Agilent, #FP-1201-0275) to analyze quality control metrics.
-
bioRxiv - Cancer Biology 2022Quote: ... and S104T mutations were introduced by use of the QuikChange Multi Site-Directed Mutagenesis Kit (Stratagene) into the pHEBO-IRF4-HAtag expression construct according to the manufactureŕs recommendations and by use of primers indicated in Extended Data Table 6 ...
-
bioRxiv - Cell Biology 2023Quote: ... pShuttle constructs were subsequently transfected into HEK293A cells using the AdEasy adenoviral production kit (Agilent Technologies). The recombinant adenovirus was plaque purified ...
-
bioRxiv - Cancer Biology 2023Quote: Mitochondrial respiration was evaluated using the Seahorse XF Cell Mito Stress Test Kit (Agilent 103015-100) with the Seahorse XFe96 Analyzer (Agilent) ...
-
bioRxiv - Biophysics 2023Quote: ... Mutations in WT hERG1a cDNA were made using the QuikChange site-directed mutagenesis kit (Agilent Technologies) and verified by DNA sequence analysis ...
-
bioRxiv - Genomics 2022Quote: The average library length was assessed using the BioAnalyzer DNA High Sensitivity kit (Agilent, 5067-4626) on an Agilent 2100 BioAnalyzer ...
-
bioRxiv - Genomics 2023Quote: ... and its integrity was determined by the Bioanalyzer 2100 kit (Agilent Technologies, Santa Clara, CA, USA). RNA libraries were prepared with the Illumina TruSeq TM RNA Sample Preparation Kit ...
-
bioRxiv - Cell Biology 2023Quote: ... The MLS-TFEB mutant was generated using the Quikchange XL site-directed mutagenesis kit (200521, Agilent). The ΔMTS mutant was generated by cloning a truncated sequence of TFEB in the pcDNA 3.1 FLAG backbone (121416 ...
-
bioRxiv - Genomics 2023Quote: Eight library preparations were carried out using the SureSelect Methyl-Seq Target Enrichment kit (Agilent, G9651) following the manufacturer’s protocol (User guide ...
-
bioRxiv - Genomics 2023Quote: ... and size distribution and degradation assessed using the Femto pulse Genomic DNA 165 kb Kit (Agilent). Purification steps were performed using AMPure PB beads (Pacific Biosciences) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sample quality assessment/size was validated by Bioanalyzer DNA-High Sensitivity Kit (Agilent Technologies, #5067-4626).
-
bioRxiv - Cancer Biology 2023Quote: FISH assay was performed on tissue microarrays using the Histology FISH accessory kit (K579911-2, Dako, Agilent Technologies ...
-
bioRxiv - Immunology 2023Quote: ... Cy3-labeled cRNA was synthesized and purified using the Low Input Quick Amp Labeling Kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... RNA quality was determined with a Bioanalyzer 2100 using an RNA 600 Nano kit (Agilent, USA). High quality of RNA was used to prepare RNA-Seq libraries with NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina® (New England BioLabs ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA quality was controlled using Agilent rna 6000 nano kit (5067-1511, Agilent, Santa Clara, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Quality control of obtained libraries was done using Agilent Bioanalyzer with High Sensitivity DNA Kit (Agilent Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... cultures were harvested and RNA extracted using Absolutely RNA Miniprep kit (Agilent Technologies, Santa Clara, CA) followed by additional DNAse treatment with Turbo DNAse (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA quantity and quality were assessed using an Agilent RNA 6000 Pico Kit (#5067-1513; Agilent) with a 2100 Bioanalyzer (#G2939BA ...
-
bioRxiv - Neuroscience 2023Quote: ... and RNA quality was assessed using the RNA 6000 Pico Assay kit (#5067-1513, Agilent Technologies). Two male medial prefrontal cortex samples (50 μg/kg Mixed BP and 150 μg/kg Mixed BP ...
-
bioRxiv - Biochemistry 2023Quote: ... Additional rounds of site directed mutagenesis using the QuikChange XL II site directed mutagenesis kit (Agilent) were applied to create Ptch1 KR (ATT/LIN)-His ...
-
bioRxiv - Cancer Biology 2023Quote: ... Library quality was assessed with a BioAnalyzer 2100 using the High Sensitivity DNA kit (Agilent Technologies). The libraries were quantified using the Kapa Library Quantification Kit Illumina Platforms (Kapa Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: ... All libraries were quantified with the Fragment Analyzer using the standard sensitivity NGS kit (Agilent Technologies) and pooled in equimolar concentrations and quantified with a Qubit Fluorometer (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... and RNA integrity number (RIN) was assessed using an RNA 6000 Nano kit (5067-1511, Agilent) on a 2100 Bioanalyzer from Agilent ...
-
bioRxiv - Molecular Biology 2023Quote: ... and RNA integrity number (RIN) was assessed using RNA 6000 Nano Kit (Agilent, Cat# 5067-1511) on Agilent Bioanalyzer 2100 ...
-
bioRxiv - Plant Biology 2023Quote: ... and quality checked using the High Sensitivity DNA or RNA Kits for Fragment Analyzer (Agilent Technologies). Only RNA samples with a RQN above 7 were kept for further use ...
-
bioRxiv - Plant Biology 2023Quote: The AtSHMT1 (AT4G37930) amino acid substitutions were generated using a site-directed mutagenesis kit protocol (Stratagene). The primer-SD was used for Ser190 Leu ...
-
bioRxiv - Microbiology 2023Quote: ... and an Advanced Analytical Fragment Analyzer System using a Fragment Analyzer RNA Kit (Agilent, Basel, Switzerland), respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... Library quality was confirmed by using the Bioanalyzer High Sensitivity DNA Kit (Agilent Technologies, 5067-4626). Four libraries were pooled for pair-end sequencing with 100 cycles on a S1 flow cell lane in an Illumina NovaSeq 6000 System (UCSF Center for Advanced Technology) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... RNA quality was assessed using Agilent RNA 6000 Nano Kit on Agilent 2100 Bioanalyzer (Agilent, USA), and samples with RNA integrity number ≥ 8.0 were used for sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... libraries were visualized on an Agilent 2100 Bioanalyzer using Agilent High Sensitivity DNA kit (Agilent Technologies) and quantified using Qubit dsDNA HS DNA Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2023Quote: ... The final amplified libraries were validated using the Agilent High Sensitivity DNA Kit (Agilent, 5067-4626) and quantified using the Qubit dsDNA HS Kit (Thermo Fisher ...
-
bioRxiv - Genomics 2023Quote: ... and library size and quality was determined via Bioanalyzer (Agilent High Sensitivity DNA Kit, 5067-4626). Libraries were first sequenced on an Illumina MiSeq using the 300-cycle kit (v2 ...
-
Cas13d-mediated isoform-specific RNA knockdown with a unified computational and experimental toolboxbioRxiv - Genomics 2023Quote: ... the RNA integrity number (RIN) was calculated using the RNA 6000 Nano Kit (Agilent #5067-1511). RIN scores ranged between 8.7-9.7 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were analyzed for insert size distribution on a 2100 BioAnalyzer High Sensitivity kit (Agilent Technologies,) 4200 TapeStation D1000 ScreenTape assay (Agilent Technologies, ...
-
bioRxiv - Cell Biology 2023Quote: ... Point mutations on GST-dyn1xA-PRR were generated using the QuickChange site-directed mutagenesis kit (Stratagene) and were cloned into pGEX-6P-1 vector (GE Healthcare) ...
-
bioRxiv - Cell Biology 2023Quote: ... The P878A mutation was generated from the WT plasmid using the Quikchange Lightning mutagenesis kit (Agilent) and primers (CCTAGGCCTCCACCAGCAGAGGAAAAGGATG ...
-
bioRxiv - Cell Biology 2023Quote: ... Amino acid substitutions and deletions were introduced by site-directed mutagenesis using the QuikChange Kit (Agilent). Sequences of the primers used are listed in the Supplementary Table S7.
-
bioRxiv - Evolutionary Biology 2023Quote: ... We measured RNA quality using the Agilent RNA 6000 Nano Kit (Agilent, Santa Clara, United States) and quantity using the Quant-it RiboGreen RNA Assay Kit (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: ... RNA integrity was assessed using the RNA 6000 Pico Kit for Bioanalyzer (Agilent Technologies #5067-1513), and mRNA was isolated from ∼1 μg of total RNA using NEB Next Poly (A ...
-
bioRxiv - Molecular Biology 2023Quote: ... Full-length WDR5-K259A and WDR5-K259E mutants were generated by Site-Directed Mutagenesis Kit (Agilent). All proteins were expressed in the E ...
-
bioRxiv - Cancer Biology 2023Quote: ... and RIN score was determined using a Bioanalyzer RNA 6000 Nano kit (Agilent, cat.no 5067-1511) in combination with the Agilent Bioanalyzer software ...
-
bioRxiv - Cell Biology 2023Quote: ... The coding sequence of FAM104A isoform 5 was mutated using the QuikChange XL II kit (Agilent) with primers FAM104A_NL-RR_fwd (5’-cct cta ctt cca cat ccg cca gac ccg cag gga ggc cca ctt cc) ...
-
bioRxiv - Neuroscience 2023Quote: ... and H486R) were then introduced into this construct by QuikChange® Site-Directed Mutagenesis Kit (Stratagene) using the corresponding primers (Primer List below ...
-
bioRxiv - Cancer Biology 2023Quote: ... and library size distribution was measured with Bioanalyzer 2100 and High Sensitivity DNA Kit (Agilent Technologies). Final DNA libraries sequencing was performed in Illumina NovaSeq 6000 platform using the NovaSeq 6000 S1 Reagent Kit 300 cycles (2 x 150 paired-end reads ...
-
bioRxiv - Microbiology 2024Quote: ... Mutations were introduced by site-directed mutagenesis using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Cancer Biology 2024Quote: ... Quality of the RNA extraction was assessed using the 2100 Bioanalyzer (Agilent, RNA 6000 Nano Kit) and selecting samples with a RNA Integrity Number (RIN ...
-
bioRxiv - Cell Biology 2024Quote: ... We performed recombinant RlmI mutations using a QuikChange Site-Directed Mutagenesis Kit (#200518, Agilent Technologies, USA).
-
bioRxiv - Neuroscience 2024Quote: ... RNA quality was checked using a 2100 Bioanalyzer with the RNA 6000 Nano kit (Agilent Technologies). The RIN for all samples was ≥ 7,7 ...
-
bioRxiv - Cancer Biology 2024Quote: ... TFRC or 4-HNE was detected by using a Dako EnVision FLEX kit (Dako, Glostrup, Denmark) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... RNA integrity number (RIN) was determined with Agilent RNA 6000 Nano Kit (Agilent, Cat. # 5067-1511) for quality check and all samples were above 8.5.