Labshake search
Citations for Agilent :
2951 - 3000 of 5977 citations for Human CD283 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... the samples were analyzed with the Agilent RNA 600 pico kit on the Bioanalyzer platform (Agilent). Furthermore ...
-
bioRxiv - Plant Biology 2021Quote: ... site directed mutagenesis was performed with QuikChange Multi Site-Directed Mutagenesis Kit (Stratagene, Santa Clara, USA) following manufacturer’s instructions ...
-
bioRxiv - Biophysics 2019Quote: ... The ΔK210 mutation was introduced into troponin-T using a QuickChange Site-Directed Mutagenesis Kit (Agilent) and verified by sequencing ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... GIT2(ΔE)/Flag and the double-deletion GIT2(ΔBCE)/Flag using the QuikChange mutagenesis kit (Stratagene). The ΔBC primers were 5’- ACTGCAAGCAAAACAAACCGGCAGAAGCTTCAAACACTCCAGAGTGAAAATTCG and 5’- GCAATTTTCACTCTGGAGTGTTTGAAGCTTCTGCCGGTTTGTTTTGCTTGCAGT to delete amino acids 415-464 ...
-
bioRxiv - Cancer Biology 2019Quote: Wobble mutant cell lines were generated using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies). The KDELR3 shRNA recognition sequence was edited (t210c_c213a_t216c_t219c_a222c ...
-
bioRxiv - Genomics 2021Quote: ... and quality was checked using the Agilent Bioanalyzer 2100 High Sensitivity DNA Kit (Agilent, Amstelveen, Netherlands). The genomic paired-end (PE ...
-
bioRxiv - Genomics 2021Quote: ... Library quality was assessed using Agilent High Sensitivity DNA Kit and the 2100 Bioanalyzer instrument (Agilent). Libraries were then normalized to 5nM and pooled in equimolar concentrations ...
-
bioRxiv - Genetics 2020Quote: ... and p.I528V) were introduced by using the QuickChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies). NT5C2 recombinant protein production and purification were performed using previously described methods [28] ...
-
bioRxiv - Immunology 2021Quote: ... The hHVEM mutant library was generated using the QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies). Full length of WT mHVEM and mutants were cloned into pmCherry-N1 vector (Clontech) ...
-
bioRxiv - Genetics 2021Quote: ... and quality controlled using an Agilent RNA 6000 Nano kit (Agilent, Cat No./ID 5067-1511) on 2100 Bioanalyzer system ...
-
bioRxiv - Biochemistry 2021Quote: ... RNA was quantitatively and qualitatively analyzed using the RNA Analysis Kit (Agilent Technologies DNF-489-0500). The RNA separation gel was mixed with an intercalating dye (AATI ...
-
bioRxiv - Physiology 2021Quote: ... RNA quality was assessed using the RNA Nano kit on an Agilent 2100 Bioanalyzer (Agilent Technologies), and RNA samples with an RNA integrity number > 8 were deemed suitable for RNA-seq experiments ...
-
bioRxiv - Neuroscience 2021Quote: ... The αSyn K96R variant was generated using the Quick-Change II site-directed mutagenesis kit (Stratagene) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Quality control and quantification of the libraries were performed using the Bioanalyzer DNA 1000 kit (Agilent) and the KAPA library quantification kit for Illumina (KAPA Biosystems) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Quality control and quantification assays were performed using High Sensitivity DNA kits on a Bioanalyzer (Agilent).
-
bioRxiv - Cell Biology 2020Quote: ... RNA-seq library preparation was done using the Agilent SureSelect Stranded kit (Agilent, Santa Clara, CA) as per the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA quality was assessed using Agilent RNA 6000 Nano Kit on Agilent 2100 Bioanalyzer (Agilent, USA), and only samples with RNA integrity number (RIN ...
-
bioRxiv - Neuroscience 2020Quote: Mitochondrial respiration was measured using Agilent’s Cell Mitochondrial Stress Test kit (Agilent Technologies, PN: 103015-100) and Seahorse XFe24 Analyzer ...
-
bioRxiv - Biochemistry 2021Quote: ... Mutagenesis reactions were performed with QuikChange II Site-Directed Mutagenesis kit (Agilent Technologies, Santa Clara, USA) following the manufacturer protocols ...
-
bioRxiv - Biochemistry 2021Quote: ... proSP-C BRICHOS D105N was obtained with QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, US), and the DNA sequence was confirmed (GATC Bioteq ...
-
bioRxiv - Biochemistry 2021Quote: ... and a serine at position 61 was replaced by a cysteine using the Quikchange kit (Agilent). GST-PHPLCδ1 was expressed in E ...
-
bioRxiv - Cell Biology 2021Quote: ... site-directed mutagenesis was performed on pCRII-mp-EGFP using a QuikChange Lightning mutagenesis kit (Agilent) to introduce two further mutations ...
-
bioRxiv - Synthetic Biology 2021Quote: ... We generated mutant libraries of each gene via random mutagenesis with the Mutazyme II kit (Agilent), using 200ng of DNA template and eight cycles of mutagenic PCR ...
-
bioRxiv - Genetics 2020Quote: ... Variants in SATB1 and SATB2 were generated using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent). The primers used for site-directed mutagenesis are listed in Suppl ...
-
bioRxiv - Neuroscience 2020Quote: ... MAP2c phosphomimetic mutant S426E was generated using the QuikChange Lightning site-directed mutagenesis kit (Agilent Technologies) and mutagenized primers (Table S5) ...
-
bioRxiv - Immunology 2022Quote: ... Total RNA integrity was assessed using an Agilent Bioanalyzer (Agilent RNA 6000 pico Kit 5067-1513) and the RIN and DV200 were calculated ...
-
bioRxiv - Bioengineering 2020Quote: RNA integrity was assessed using the RNA 6000 Pico Kit for Bioanalyzer (Agilent Technologies #5067-1513), and mRNA was isolated from ~1 μg of total RNA using NEBNext Poly(A ...
-
bioRxiv - Cancer Biology 2020Quote: ... Library fragment size was determined using the DNA 1000 Kit on the Agilent Bioanalyzer (Agilent Technologies). Libraries were quantified by qPCR using the KAPA Library Quantification Kit (KAPA Biosystems) ...
-
bioRxiv - Cancer Biology 2020Quote: ... for 27 samples sequenced using the SureSelectXT kit (75 MB; Agilent Technologies, Santa Clara, CA, USA), and 104X and 102X for tumor and normal ...
-
bioRxiv - Developmental Biology 2020Quote: ... Samples validation was performed on a Bioanalyzer 2100 using High Sensitivity DNA analysis kit (both Agilent) and sequenced on a MiSeq (Illumina).
-
bioRxiv - Cancer Biology 2021Quote: ... Libraries were controlled for fragment size using the High Sensitivity DNA analysis kit (Agilent, 5067-4626) on an Agilent Bioanalyzer 2100 ...
-
bioRxiv - Cancer Biology 2020Quote: ... ECAR was detected using Seahorse XF Glycolysis Stress Test kit (Agilent Technologies, Santa Clara, CA, USA) according to the manufacturer’s handbook ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and quantified using an Agilent Bioanalyzer 2100 DNA 1000 kit (Agilent Technologies, Santa Clara, CA, USA). Libraries were pooled at equimolar concentrations into two pools of six prior to probe hybridization following the Arbor Biosciences myBaits protocol v 3.0.1 and Hale et al ...
-
bioRxiv - Genetics 2021Quote: ... Concentration and quality were assessed using the Agilent BioAnalyzer RNA 6000 Pico Kit (Agilent; 5067-1514). RNA was normalized to 0.5ng/µl for cDNA synthesis using the SuperScript IV VILO Master Mix (ThermoFisher ...
-
bioRxiv - Genetics 2021Quote: ... DNA quality was characterized using the Fragment Analyzer (with the Genomic DNA 50 kb kit; Agilent).
-
bioRxiv - Genomics 2021Quote: ... before standard library quality control with standard sensitivity NGS Fragment kit (Agilent, Santa Clara, CA, USA). Quantification was performed in a qPCR with Kapa Library quantification kit (Roche ...
-
bioRxiv - Genomics 2020Quote: ... Library quality was determined through the High Sensitivity DNA Kit on a Bioanalyzer 2100 (Agilent Technologies). Multiplexed libraries were sequenced as HiSeq400 100PE runs ...
-
bioRxiv - Plant Biology 2020Quote: ... prior to the first-strand cDNA synthesis using AffinityScript RT-qPCR cDNA synthesis kit (Agilent Technologies). RT-qPCR analysis was conducted using iQ SYBRGreen Supermix (Bio-Rad ...
-
bioRxiv - Microbiology 2020Quote: ... Point mutations N74D and A77V were introduced using the QuikChange II site-directed mutagenesis kit (Stratagene) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: Site-directed mutagenesis was carried out with a QuickChange® Lightning Site-Directed Mutagenesis Kit (Agilent) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Mutations were introduced by site-directed mutagenesis using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Immunology 2020Quote: ... All point mutations were introduced with a QuickChange II XL site-directed mutagenesis kit (Agilent Technologies). All constructs were confirmed by sequencing ...
-
bioRxiv - Immunology 2021Quote: Antibody gene mutations were introduced by QuikChange II site directed mutagenesis kit (Agilent, Cat. No. 200524)
-
bioRxiv - Immunology 2020Quote: ... Single mutations were introduced using QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA, USA). The bicistronic vector consists of C1-Pro VC and C1-Pro VN linked with a 2A peptide ...
-
bioRxiv - Immunology 2021Quote: ... Quality was assessed on the Agilent 2100 Bioanalyser using the High Sensitivity DNA Kit (Agilent, USA), and quantification was based on the Qubit DNA HS Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2019Quote: ... heat-induced antigen retrieval was performed in Tris/EDTA pH9 buffer (EnVision FLEX Dako kit, K8010), followed by staining with primary antibody (CD8 clone 4B11 ...
-
bioRxiv - Microbiology 2021Quote: ... Site-directed mutagenesis was done according to manufacturer’s recommendation using a QuikChange Lightning kit (Agilent Genomics) as we have previously described (11 ...
-
bioRxiv - Genetics 2021Quote: The libraries were subjected for the hybridization capture using the SureSelect Target Enrichment Kit (Agilent, USA), following the instruction of the reagent supplier ...
-
bioRxiv - Biochemistry 2020Quote: Mitochondrial respiration was evaluated using the Seahorse XFe Cell Mito Stress Test Kit (Agilent #103015-100) following the manufacturer instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... DNA fragment size was determined using the DNA 1000 Kit on the Bioanalyzer 2100 (Agilent Technologies). A custom-made Agilent SureSelectXT Target Enrichment Library (Cat No ...