Labshake search
Citations for Agilent :
3101 - 3150 of 6226 citations for Cow Protein L Isoaspartate PCMT1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... was used following the manufacturer’s instructions for XF Cell Mito Stress Test Kit (103015-100, Agilent). In this test ...
-
bioRxiv - Biochemistry 2021Quote: ... CCH-1 and CCH-10 EGFR sequences using Quikchange Lightning site-directed mutagenesis kit (Agilent Technologies), according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Mutations within the A3R were made using the QuikChange Lightening Site-Directed Mutagenesis Kit (Agilent Technologies) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... The CyldS7A ser-to-ala mutations were generated using Quikchange Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Biochemistry 2021Quote: ... The libraries were profiled using a High Sensitivity DNA kit on a 2100 Bioanalyzer (Agilent Technologies) and quantified using the dsDNA HS Assay Kit in a Qubit 2.0 Fluorometer (Life Technologies) ...
-
bioRxiv - Biochemistry 2021Quote: Antibody gene mutations were introduced by QuikChange II site directed mutagenesis kit (Agilent, Cat. No. 200524)
-
bioRxiv - Biochemistry 2020Quote: ... The PcATP2-D596N mutant was obtained using the QuikChange II XL site-directed mutagenesis kit (Agilent). The nine Cdc50 subunits sequences were cloned in the pYeDP60 vector between the EcoRI and BamHI restriction sites ...
-
bioRxiv - Microbiology 2021Quote: ... and rRNA removal was evaluated using the Bioanalyzer RNA Pico Kit (Agilent, Santa Clara, CA, USA). Strand-specific ...
-
bioRxiv - Developmental Biology 2022Quote: ... and an Advanced Analytical Fragment Analyzer System using a Fragment Analyzer RNA Kit (Agilent, DNF-471), respectively ...
-
bioRxiv - Developmental Biology 2022Quote: ... Quality control of input RNA was performed using the RNA 6000 Pico kit (Agilent, #5067–1513) on a 2100 Bioanalyzer (Agilent ...
-
bioRxiv - Microbiology 2022Quote: ... primers were designed according to the protocol of the QuickChange II Site-directed mutagenesis kit (Agilent) and as listed in table S2 ...
-
bioRxiv - Immunology 2022Quote: ... or Sub viruses by either site directed mutagenesis (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent Technologies) or DNA synthesis (GenScript ...
-
bioRxiv - Cancer Biology 2022Quote: We used the Seahorse XF Long Chain Fatty Acid Oxidation Stress Test kit (Agilent, 102720-100). Cells were incubated in assay media supplemented with 150 µM BSA or oleic acid conjugated to BSA as fatty acid substrate in the following formulation ...
-
bioRxiv - Genetics 2022Quote: ... The mutagenesis was performed with the Quickchange-XLsite-directed Mutagenesis Kit (Agilent Technologies, Santa Clara, USA) and custom-designed primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... Constructed libraries for sequencing were quantified using the Agilent 2100 BioAnalyzer high sensitivity DNA kit (Agilent). Two or three libraries for each region of the stage-3 embryo were sequenced in single-end runs in the antisense direction using the MiSeq reagent kit V3 (150 cycles ...
-
bioRxiv - Biochemistry 2022Quote: ... Site-directed mutagenesis was carried out using QuikChange II XL site-directed mutagenesis kit (Agilent Technologies) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The GCTG cut site was mutated to TAGC using the QuickChange site directed mutagenesis kit (Agilent). 51 base pair constructs were generated by PCR amplification of their respective 99 base pair constructs ...
-
bioRxiv - Neuroscience 2022Quote: ... Library concentration and size distribution were determined using an Agilent Bioanalyzer DNA 1000 Kit (Agilent Technologies). Three samples were run per flowcell lane using barcoding ...
-
bioRxiv - Biochemistry 2019Quote: ... All the mutations were introduced with the QuikChange II XL site-directed mutagenesis kit (Stratagene, 200522) and confirmed by DNA sequencing ...
-
bioRxiv - Cell Biology 2020Quote: ... All mutations in the plasmids were generated by site-directed mutagenesis using a QuikChangeII kit (Agilent) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... and isotype control: Glycans were prepared using the GlykoPrep® Rapid N-Glycan Preparation kit (PROzyme) and separated by Hydrophilic-Interaction Liquid Chromatography (HILIC ...
-
bioRxiv - Systems Biology 2019Quote: ... Library fragment size was determined using the DNA 1000 Kit on the Agilent Bioanalyzer (Agilent Technologies). Libraries were quantified by qPCR using the KAPA Library Quantification Kit (KAPA Biosystems) ...
-
bioRxiv - Cancer Biology 2019Quote: ... IHC was performed with the DAKO EnVision+ System-HRP kit (cat# K4006, Agilent, Santa Clara, CA). Antigen retrieval was performed using Target Retrieval Solution for 20 minutes at > 90°C ...
-
bioRxiv - Cell Biology 2019Quote: ... All mutations in the plasmids were generated by site-directed mutagenesis using a QuikChangeII kit (Agilent) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... The RNA integrity was evaluated using a 2100 Bioanalyzer with the RNA 6000 Nano kit (Agilent) where samples with an RNA integrity number (RIN ...
-
bioRxiv - Cancer Biology 2019Quote: ... The libraries were validated using the Agilent 2100 Bioanalyser and a high-sensitivity kit (Agilent Technologies) to ascertain the insert size ...
-
bioRxiv - Molecular Biology 2019Quote: ... The quality of purified libraries was assessed using a Bioanalyzer High-Sensitivity DNA Analysis kit (Agilent). For ATAC-seq ...
-
bioRxiv - Plant Biology 2020Quote: ... and the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). The RNA-seq libraries were generated using NEBNext® Ultra™ RNA Library Prep Kit for Illumina® (NEB ...
-
bioRxiv - Pathology 2021Quote: ... Asic2b N416A and Asic2b N443A mutants were generated using Quickchange Site-Directed Mutagenesis kit (Agilent Technologies) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... site-directed mutagenesis was carried out with the Quick Change II Site-directed mutagenesis Kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2020Quote: ... we performed DNA shuffling75 followed by error-prone PCR (GeneMorph II Random Mutagenesis Kit, Agilent Technologies). The DNA shuffled and error-prone PCRed library is hereafter referred to as the “Shuffled Library.”
-
bioRxiv - Microbiology 2020Quote: ... purified (Agencourt® AMPure® XP Beads) and quality-checked (High Sensitivity DNA Kit, Agilent Technologies). The final library was quantified (KAPA Library Quantification Kit ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Mutations within the A1R were made using the QuikChange Lightening Site-Directed Mutagenesis Kit (Agilent Technologies) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Pathology 2021Quote: The avrE-yy mutation was made using the QuickChange II site-directed mutagenesis kit (Agilent Technologies). pENTR/D-TOPO:avrE was used as a template for quick change PCR ...
-
bioRxiv - Systems Biology 2020Quote: ... RNA integrity was verified with Agilent RNA 6000 Nano kit on the 2100 Bioanalyzer (Agilent Technologies) or HS RNA Kit (15 nt ...
-
bioRxiv - Cell Biology 2020Quote: ... This clone was subsequently used for mutagenesis using the QuickChange Ligthning site-directed mutagenesis kit (Agilent). The putative weak NLS motif GLVMKRFRLS detected in the C-terminal domain of dTBCE was mutated into GLVMAAFALS to generate pENTR-dTBCEmutNLS ...
-
bioRxiv - Molecular Biology 2020Quote: ... an AfeI site was introduced by site-directed mutagenesis using the QuikChange II XL kit (Agilent) and oligos RU-O-22971 and RU-O-22972 ...
-
bioRxiv - Genomics 2020Quote: ... and quantified using an Agilent Bioanalyzer 2100 DNA 1000 kit (Agilent Technologies, Santa Clara, CA, USA). Libraries were pooled at equimolar concentrations into sixteen pools of six prior to probe hybridization to targeted capture probes following the Arbor Biosciences myProbes protocol v 3.0.1 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... the Agilent 2100 Bioanalyzer system and Agilent RNA 6000 Nano Kit (Agilent, Cat. No. 5067-1511) were used to measure the RNA integrity number for each sample ...
-
bioRxiv - Genomics 2021Quote: ... the samples were analyzed with the Agilent RNA 600 pico kit on the Bioanalyzer platform (Agilent). Furthermore ...
-
bioRxiv - Plant Biology 2021Quote: ... site directed mutagenesis was performed with QuikChange Multi Site-Directed Mutagenesis Kit (Stratagene, Santa Clara, USA) following manufacturer’s instructions ...
-
bioRxiv - Biophysics 2019Quote: ... The ΔK210 mutation was introduced into troponin-T using a QuickChange Site-Directed Mutagenesis Kit (Agilent) and verified by sequencing ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... GIT2(ΔE)/Flag and the double-deletion GIT2(ΔBCE)/Flag using the QuikChange mutagenesis kit (Stratagene). The ΔBC primers were 5’- ACTGCAAGCAAAACAAACCGGCAGAAGCTTCAAACACTCCAGAGTGAAAATTCG and 5’- GCAATTTTCACTCTGGAGTGTTTGAAGCTTCTGCCGGTTTGTTTTGCTTGCAGT to delete amino acids 415-464 ...
-
bioRxiv - Cancer Biology 2019Quote: Wobble mutant cell lines were generated using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies). The KDELR3 shRNA recognition sequence was edited (t210c_c213a_t216c_t219c_a222c ...
-
bioRxiv - Genomics 2021Quote: ... and quality was checked using the Agilent Bioanalyzer 2100 High Sensitivity DNA Kit (Agilent, Amstelveen, Netherlands). The genomic paired-end (PE ...
-
bioRxiv - Genomics 2021Quote: ... Library quality was assessed using Agilent High Sensitivity DNA Kit and the 2100 Bioanalyzer instrument (Agilent). Libraries were then normalized to 5nM and pooled in equimolar concentrations ...
-
bioRxiv - Genetics 2020Quote: ... and p.I528V) were introduced by using the QuickChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies). NT5C2 recombinant protein production and purification were performed using previously described methods [28] ...
-
bioRxiv - Immunology 2021Quote: ... The hHVEM mutant library was generated using the QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies). Full length of WT mHVEM and mutants were cloned into pmCherry-N1 vector (Clontech) ...
-
bioRxiv - Genetics 2021Quote: ... and quality controlled using an Agilent RNA 6000 Nano kit (Agilent, Cat No./ID 5067-1511) on 2100 Bioanalyzer system ...
-
bioRxiv - Biochemistry 2021Quote: ... RNA was quantitatively and qualitatively analyzed using the RNA Analysis Kit (Agilent Technologies DNF-489-0500). The RNA separation gel was mixed with an intercalating dye (AATI ...