Labshake search
Citations for Agilent :
3351 - 3400 of 6226 citations for Cow Protein L Isoaspartate PCMT1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... and the size was determined using the TapeStation 4200 with a High Sensitivity D1000 kit (Agilent). All libraries were mixed into a single tube with equal molarity ...
-
bioRxiv - Cell Biology 2024Quote: ... and the High Sensitivity NGS Fragment 1-6000bp kit on a 48-channel Fragment Analyzer (Agilent), respectively ...
-
bioRxiv - Developmental Biology 2024Quote: The quality of purified chromatin was assessed using the Bioanalyzer High Sensitivity DNA Analysis kit (Agilent). Libraries were sequenced using the NextSeq 500/550 Mid Output Kit v2.5 (150 Cycles ...
-
bioRxiv - Neuroscience 2024Quote: RNA quality was checked using a 2100 Bioanalyzer with the RNA 6000 Nano kit (Agilent Technologies). The RIN for all samples was ≥8.7 ...
-
bioRxiv - Biophysics 2021Quote: ... the cells were transiently transfected using either MBS mammalian transfection kit (Agilent Technologies, Stratagene, La Jolla, CA) or Lipofectamine 3000 transfection kit (Invitrogen ...
-
bioRxiv - Biophysics 2021Quote: ... the cells were transiently transfected using either MBS mammalian transfection kit (Agilent Technologies, Stratagene, La Jolla, CA) or Lipofectamine 3000 transfection kit (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... and analyzed by using a High Sensitivity DNA Kit on a Bioanalyzer 2100 (Agilent, Santa Clara, CA).
-
bioRxiv - Biochemistry 2020Quote: Variant enzymes were generated using the QuickChange Site-Directed Mutagenesis kit as per manufacturer’s instructions (Agilent technologies), verified by DNA sequencing and purified as for the wild-type protein.
-
bioRxiv - Cancer Biology 2021Quote: ... purified libraries were validated and quantified using an Agilent Bioanalyzer High Sensitivity DNA Kit (Agilent, Cat#: 50674626) and a Qubit dsDNA High Sensitivity Quantitation Assay (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: ... and the size distribution was confirmed with High Sensitivity DNA Kit for Bioanalyzer (Agilent Technologies #5067-4626). Libraries were sequenced on Illumina HiSeq2500 in single read mode with the read length of 50 nt following manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... The quality of purified DNA libraries was assessed using the Agilent High Sensitivity DNA kit (Agilent Technologies). Paired end ...
-
bioRxiv - Cell Biology 2020Quote: ... and SV40 large T antigen (LT) were introduced using the QuikChange Site-Directed Mutagenesis kit (Agilent Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... Point mutations in FAM111A and FAM111B were introduced using the QuikChange Site-Directed Mutagenesis kit (Agilent Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... P96R-H31Q and F100I-H31Q mutations were generated with the Quick Change Mutagenesis Kit (Agilent Technologies #200517). Human TDP-43 fused to pCherry was described previously [32] ...
-
bioRxiv - Cell Biology 2020Quote: Mutations in PKCε were introduced with the QuikChange XL site-directed mutagenesis kit (Stratagene, La Jolla, CA). The following primers were used for PCR ...
-
bioRxiv - Immunology 2021Quote: ... Sample concentration and quality was measured using the HighSensitivity RNA TapeStation kit for the TapeStation Bioanalyzer (Agilent). After confirming the RNA was of sufficient quality using the RINe metric ...
-
bioRxiv - Immunology 2021Quote: ... The staining was visualized using the ABC reagent (ABC vector kit; Vector) and DAB substrate chromogen (Dako). Apoptotic cells in atherosclerotic lesions were stained using the Click-iT Plus TUNEL Assay kit (Thermo Fisher ...
-
bioRxiv - Genetics 2021Quote: ... performed DNA library preparation and whole-exome sequencing using Agilent SureSelect Mouse All ExonV6 kit (Agilent Technologies) following recommendations of manufacturer ...
-
bioRxiv - Genetics 2021Quote: ... Library quality was validated using a 2100 Bioanalyzer with the Agilent High-Sensitivity DNA Kit (Agilent Technologies). The library was sequenced on an Illumina HiSeq 1500 platform by paired-end sequencing (100 bp ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then incubated with horseradish peroxidase-linked secondary antibody from the Envision Kit (Dako, K-5007) for 1 hour (100 µl/section ...
-
bioRxiv - Molecular Biology 2021Quote: ... and quality checked with the Agilent High Sensitivity DNA Kit 5067-4626 on a Bioanalyzer (Agilent, USA). Sequencing on the Illumina NextSeq platform was completed using NextSeq™ 500/550 High Output Kit v2.5 (75 Cycles ...
-
bioRxiv - Developmental Biology 2021Quote: ... Samples were transferred in 100 ul of ice-cold lysis solution (Agilent Absolutely RNA Nanoprep kit #400753), homogenized though brief pipetting ...
-
bioRxiv - Biochemistry 2021Quote: ... and an Advanced Analytical Fragment Analyzer System using a Fragment Analyzer NGS Fragment Kit (Agilent, DNF-473), respectively ...
-
Distal regulation, silencers and a shared combinatorial syntax are hallmarks of animal embryogenesisbioRxiv - Developmental Biology 2021Quote: ... The quality of each individual library was assessed using a Bioanalyzer High-Sensitivity DNA Analysis kit (Agilent). Equal volumes of libraries from three individual replicates for each stage were then pooled and run again on the Bioanalyser ...
-
bioRxiv - Developmental Biology 2020Quote: ... was cloned by TA-cloning in the pSC-A vector using the StrataClone PCR Cloning Kit (Agilent). The vgll4a-HA fragment was thereafter obtained from the pCS-A construct using EcoRI/XhoI digestion and cloned in the pCS2 vector ...
-
bioRxiv - Genomics 2020Quote: ... and by determining library fragment sizes with the Agilent High Sensitivity DNA Analysis kit (Agilent, 5067-4626) on Agilent 2100 Bioanalyzer Station (Agilent ...
-
bioRxiv - Physiology 2022Quote: ... Point mutations were made using Quickchange II XL Site-Directed Mutagenesis kit (Agilent technologies, Santa Clara, CA). The human KCNQ2 and human KCNQ3 constructs were fused with sequence of the enhanced YFP at the carboxyl-terminal end ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: We measured both amplicon sizes and cDNA concentrations using an Agilent High Sensitivity DNA Kit (Agilent Technologies) according to the manufacturer’s recommendation ...
-
bioRxiv - Molecular Biology 2020Quote: Phosphorylated residues of Spt5 were substituted with Ala or Asp using site-directed mutagenesis kits (Agilent Technologies), the oligonucleotides listed in Supplementary Table 1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 200 ng of total RNA was labeled with the one-color Quick Amp labeling kit (Agilent Technologies).
-
bioRxiv - Molecular Biology 2021Quote: In vitro transcribed RNAs were analyzed by high resolution electrophoresis using the RNA 6000 Nano Kit (Agilent). Purified RNA transcript solutions were incubated at 95 °C for 2 min for denaturation ...
-
bioRxiv - Cell Biology 2022Quote: ... The total RNA was isolated using the Absolutely RNA microprep kit (Agilent Technologies, Santa Clara, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... and 1.4 μM rotenone/antimycin A in port B (Agilent Seahorse XFp cell mito stress test kit). Four readings were taken for basal respiration ...
-
bioRxiv - Cell Biology 2022Quote: CircRNA quality was assessed with a Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit (Agilent, CA, USA), allowing a minimum RNA integrity number (RIN ...
-
bioRxiv - Genomics 2020Quote: ... The NGS libraries were constructed using the SureSelect Library Prep Kit (Agilent Technologies, Palo Alto, CA, USA). Quantification of the library was performed using the Agilent DNA 1000 Kit (Agilent Technologies) ...
-
bioRxiv - Genomics 2020Quote: ... The products were purified using AgencourtAMPure XP Beads and quantified using the Agilent DNA 12000 Kit (Agilent). Sequencing primer annealing and polymerase binding to the PacBio SMRTbell Templates were performed using the manufacturer’s recommendations (PacBio ...
-
bioRxiv - Genomics 2020Quote: ... The quality of the RNA was checked with Bioanalyzer 2100 using the ‘RNA 6000 Nano kit’ (Agilent). RNA samples with RIN values >7 were used for further analysis ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were assessed in an Agilent 2100 bioanalyzer with the DNA 1000 Kit (Agilent, Santa Clara, California) to determine average length ...
-
bioRxiv - Cell Biology 2019Quote: ... Purified total RNA was quantified by using the Agilent RNA 6000 Nano kit (Cat# 5067-1511, Agilent) on an Agilent 2100 Bioanalyzer (Agilent) ...
-
bioRxiv - Cancer Biology 2019Quote: Site-directed mutagenesis to generate the mutant RAS clones was performed with a QuikChange mutagenesis kit (Stratagene) and the primers for amino acid 180 site mutation of KRAS4A are CAGCAAAGAAGAAAAGACTCCTGGCAGTGTGAAAATT and AATTTTCACACTGCCAGGAGTCTTTTCTTCTTTGCTG.
-
bioRxiv - Molecular Biology 2019Quote: ... Point mutants in the yeast Ddi1 sequence were generated using the QuikChange Site-Directed Mutagenesis Kit (Agilent). Entry clones bearing domain deletions ...
-
bioRxiv - Genetics 2019Quote: ... Total RNA was isolated using the Absolutely RNA Mini Prep Kit (Agilent Technologies Inc., Santa Clara, CA), and was reverse transcribed using the iScript cDNA Synthesis Kit (Bio-Rad Laboratories) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Libraries were quantified by qPCR with the quality checked using a Bioanalyzer DNA 7500 Kit (Agilent Technologies). Pooled libraries were sequenced on the Illumina NextSeq or MiSeq platform using a 2 x75bp paired-end mode ...
-
bioRxiv - Cancer Biology 2019Quote: 3D-FISH was performed using the Dako FISH Histology accessory kit from Agilent (Catlog no: K579911-5) as per manufacturer guidelines ...
-
bioRxiv - Genetics 2020Quote: ... The quality of the library was checked using an Agilent 2100 Bioanalyzer (Agilent High Sensitivity DNA kit). Sequencing was performed by HiSeq 2500 (Illumina ...
-
bioRxiv - Systems Biology 2019Quote: ... was labeled with Cy3 during transformation into cDNA using an RNA Agilent miRNA Labeling Kit (Agilent, UK) and Spike Kit (Agilent ...
-
bioRxiv - Systems Biology 2019Quote: ... and quality of the RNA is established using the Bioanalyzer RNA Nano kit (Agilent Technologies, 5067-1511), it is recommended that RNA with an RNA Integrity Number (RIN ...
-
bioRxiv - Neuroscience 2019Quote: ... pPBase-BRAFwt was generated with quick change II XL single nucleotide site directed mutagenesis kit from Agilent according to the manufacturer protocol ...
-
bioRxiv - Bioengineering 2019Quote: Site-directed mutagenesis was carried out with the QuikChange XL Site-Directed Mutagenesis Kit (Agilent Technologies, US), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... and an RNA 6000 Nano Kit with the Bioanalyzer 2100 system (Agilent Technologies, Santa Clara, CA, USA). The TruSeq RNA Library Preparation Kit (Illumina ...