Labshake search
Citations for Agilent :
251 - 300 of 1583 citations for Tumor necrosis factor receptor superfamily member 3 LTBR Mouse HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... anti-mouse (Dako,catalog no. P0260), and anti-mouse (ZSGB-BIO ...
-
bioRxiv - Cancer Biology 2023Quote: ... goat anti-mouse IgG (Dako Agilent), and Peroxidase AffiniPure Donkey Anti-Human IgG (Jackson ImmunoResearch ...
-
bioRxiv - Pathology 2023Quote: ... Envision® + system (anti-mouse) (Dako, https://www.agilent.com/en/dako-products ...
-
bioRxiv - Molecular Biology 2023Quote: ... HRP-anti-mouse IgG (Dako, P0260), HRP-anti-rabbit IgG (Dako ...
-
bioRxiv - Cancer Biology 2023Quote: ... goat anti-mouse IgG (Dako Agilent), and Peroxidase AffiniPure Donkey Anti-Human IgG (Jackson ImmunoResearch ...
-
bioRxiv - Genomics 2020Quote: ... A D1000 Screen Tape assay (Agilent, Cat.5067-5582/3) was used with the 2200 Tape Station (Agilent Technologies ...
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cytokeratin (AE1/3) and vimentin (V9) were purchased from Dako Agilent Technologies ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and endogenous peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 x 2.0 mm Polaris 3 C8-A column (Agilent, Middelburg ...
-
bioRxiv - Microbiology 2024Quote: ... or 3) a HiPlex H column (4.6 x 250mm, Agilent). For 1) ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Immunology 2023Quote: ... using 1 µg/mL of rat anti-mouse IgM (AbD Biotec) or rabbit anti-mouse IgG1 (Dako) capture antibody ...
-
bioRxiv - Cell Biology 2023Quote: ... the following antibodies were used: anti IR (D2) mouse IgG110 [34] and mouse IgG1 Neg control (DAKO). The kinase inhibitors used were cobimetinib (S8041 ...
-
bioRxiv - Microbiology 2021Quote: ... and the AEC substrate 3-amino-9-ethylcarbazole (Dako, Carpinteria, CA). Moreover ...
-
bioRxiv - Systems Biology 2020Quote: ... block 3-6: PCR amplification from the synthetic library (Agilent Technologies) according to mutation families) ...
-
bioRxiv - Immunology 2022Quote: ... Samples were analyzed with a 3-laser flow cytometer (Agilent Novocyte) and data were processed with FlowJo (v10.1) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and luminescence was measured using a Cytation 3 Image Reader (Agilent). The luminescence of vehicle-treated controls was set to 100% ...
-
bioRxiv - Cancer Biology 2022Quote: ... and luciferase activities were measured with Cytation 3 Image Reader (Agilent). Firefly luciferase activities were normalized to those of the Renilla luciferase.
-
bioRxiv - Cancer Biology 2024Quote: ... Absorbase (450nm) was red with BioTek Cytation 3 (Agilent, California, US).
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was quantified using the Gen5 Take 3 Module (Agilent BioTek) and assessed for quality with 260/230 absorbance ratio ...
-
bioRxiv - Cancer Biology 2021Quote: ... or Mouse EnVision+ System-HRP (K4007, Dako) for 30’ ...
-
bioRxiv - Cell Biology 2020Quote: ... Goat Anti-Mouse/Rabbit Immunoglobulins/HRP (Dako) secondary antibodies were used to detect primary antibodies ...
-
bioRxiv - Immunology 2021Quote: ... followed by goat anti-mouse HRP (DAKO) antibody ...
-
bioRxiv - Biophysics 2022Quote: ... and Goat-anti-mouse (Cat# P0447, Dako) 1:5,000 in 5% BSA were used ...
-
bioRxiv - Molecular Biology 2020Quote: ... HRP-coupled secondary anti-mouse (Dako P0260), anti-mouse light chain specific (Millipore AP200P) ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse anti-FLAG (Agilent, 1:800 dilution), rabbit anti-V5 (GenScript ...
-
bioRxiv - Immunology 2021Quote: ... and mouse anti-HIV-1 P24 (Dako), as primary antibodies ...
-
bioRxiv - Cancer Biology 2019Quote: ... mouse anti-human CK20 (Dako, cat. #M7019), mouse anti-human CDX2 (BioGenex ...
-
bioRxiv - Developmental Biology 2020Quote: ... secondary biotinylated goat anti-mouse antibody (Dako) was added to the slides 1/400 in blocking buffer ...
-
bioRxiv - Molecular Biology 2019Quote: ... and Rabbit anti-Mouse HRP(Dako #P0161).
-
bioRxiv - Developmental Biology 2021Quote: ... mouse anti-VIMENTIN 1:500 (M0725, DAKO), rabbit anti-NFIA 1:250 (NBP-1-81406 ...
-
bioRxiv - Cancer Biology 2021Quote: ... mouse anti-Ki67 (1:50, Dako, M7240), rabbit anti-LYZ (1:1500 ...
-
bioRxiv - Cancer Biology 2021Quote: ... mouse anti-CK17 (1:10, Dako, M7046), mouse anti-MMP7 (1:100 ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-mouse and anti-goat antibodies (Dako) were diluted 1:10,000 in 1% BSA/PBST ...
-
bioRxiv - Microbiology 2021Quote: ... sections were incubated with Mouse linker (Dako), then visualised using an Envision Flex horseradish peroxidase (HRP)-secondary antibody (DM822 ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse anti-S100 (Dako, Z0311, 1:250), rat anti-CD68 (Biorad ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-BrdU (Dako, M0744, 1:50), rabbit anti-Ki67 (Abcam ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-PCNA Clone PC10 (Dako, M0879) at 1:500 following antigen retrieval ...
-
bioRxiv - Immunology 2020Quote: ... followed by goat anti-mouse HRP (DAKO) antibody ...
-
bioRxiv - Cancer Biology 2021Quote: ... Polyclonal rabbit anti-mouse immunoglobulins/FITC (DAKO) were used as secondary antibodies for STn detection at a 1:100 dilution in PBS 2% FBS for 15 minutes at room temperature ...
-
bioRxiv - Pathology 2022Quote: ... rabbit anti-mouse HRP (1/100, Dako), goat anti-rabbit Alexa Fluor 488 (1/200 ...
-
bioRxiv - Physiology 2022Quote: ... Monoclonal mouse anti-CD3 (Dako, Glostrup, Denmark) and anti-α-SMA (Sigma Chemical CO ...
-
bioRxiv - Cell Biology 2019Quote: ... Horseradish peroxidase-conjugated anti-mouse (Dako, P0260) or anti-rabbit (GE Healthcare Life Sciences ...
-
bioRxiv - Molecular Biology 2019Quote: ... HRP-conjugated anti-mouse IgG (P0447, Dako) was used as secondary antibody diluted 1 in 1000 and then incubated at room temperature for 45 min for protein visualization.
-
bioRxiv - Cell Biology 2020Quote: ... secondary anti-mouse (Agilent P0260, 1:10.000), secondary anti-rat (Santa Cruz 2032 ...
-
bioRxiv - Molecular Biology 2021Quote: ... goat anti-mouse (P447 DAKO, 1:2000) and rabbit anti-goat (P449 ...
-
bioRxiv - Cancer Biology 2020Quote: ... monoclonal mouse anti-human CD68 (M0814, Dako), rabbit anti-human vWF antibody (A0082 ...
-
bioRxiv - Cell Biology 2019Quote: ... or goat anti-mouse (1:5000) (Dako). Immunoblots were developed using Chemiluminescent ECL western blotting detection reagents (ECL™Prime Western Blotting System ...
-
bioRxiv - Cancer Biology 2019Quote: ... anti-Mouse Envision-HRP (DAKO, one hour) as secondary antibody ...