Labshake search
Citations for Agilent :
151 - 200 of 1583 citations for Tumor necrosis factor receptor superfamily member 3 LTBR Mouse HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2020Quote: ... Acetone was measured using an agilent DB-35MS column (30 m 3 0.25mm i.d. 3 0.25 mm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...
-
bioRxiv - Immunology 2019Quote: ... and 20μg/mL anti-Ki67 (TEC-3, Dako) antibodies diluted in TBS with 2% donkey serum for 3 hours at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fragment 3 was pBluescript KS (-) (Stratagene, California USA), which was digested using Xba ...
-
bioRxiv - Pathology 2021Quote: ... 3′-diaminobenzidine tetra-hydrochloride chromogen (DAB, K3468, Dako) was added to all sections and the reaction was stopped with distilled water ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2023Quote: ... then labeled using Cyanin-3 CTP (Agilent Technologies) and hybridized on chips containing 45000 probes (4×44K Whole Human Genome) ...
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm 2.7 μm HPLC column (Agilent) with a Poroshell 120 PFP ...
-
bioRxiv - Immunology 2021Quote: ... we changed three amino acids within the Fc region by using the QuikChange II site directed mutagenesis kits (Agilent, #200523), introducing M257Y ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated with 1 μg/mL recombinant anti-PSD95 antibody (Rabbit Fc fusion, NanoTag Biotechnologies #N3783) diluted in Dako REAL Antibody Diluent (S2022, Agilent) for 1 h at RT ...
-
bioRxiv - Immunology 2024Quote: ... and MØ cell culture media was replaced with FCS-and bicarbonate-free DMEM medium supplemented with 4.5 mg ml-1 D-glucose and 2 mM glutamine (Agilent, USA) for another 60 min incubation at 37°C without CO2 ...
-
bioRxiv - Cancer Biology 2020Quote: ... HRP-conjugated secondary antibodies used for detection were diluted 1:5000 (HRP-mouse anti rat, Cell Signaling Technology, Danvers, MA, Cat# CS7077S; HRP-mouse anti mouse, Dako, Agilent, Santa Clara ...
-
bioRxiv - Cancer Biology 2020Quote: ... HRP-conjugated secondary antibodies used for detection were diluted 1:5000 (HRP-mouse anti rat, Cell Signaling Technology, Danvers, MA, Cat# CS7077S; HRP-mouse anti mouse, Dako, Agilent ...
-
bioRxiv - Biochemistry 2019Quote: ... with a Supelco Discovery BIO wide Pore C18-3 column (4.6 x 150 mm, 3 µm particle size) using an Agilent 1260 High pressure Gradient System (Agilent, Waldbronn, Germany). The column was operated with a flow rate of 1 mL/min and performed ultrapure water with 0.1% (v/v ...
-
bioRxiv - Bioengineering 2021Quote: ... were extracted from freeze-dried sludge samples with a 3 h digestion time and 3% sulfuric acid and then analyzed by a gas chromatography-mass spectrometry (GC-MS) (Agilent, USA) with 7890A-5975C model (Lanham et al. ...
-
bioRxiv - Microbiology 2019Quote: ... Bound anti-mouse antibodies were detected with FITC-conjugated rabbit anti-mouse (Dako, Denmark) diluted 1:500 in TBS ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse Cnga1 and Cngb1 were amplified from mouse retina cDNA (Stratagene, La Jolla, CA); the Myc epitope was added using overlap extension PCR ...
-
bioRxiv - Immunology 2021Quote: The KA and LALA mutations were introduced to the Fc fragment of 2219 by QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies) according to the instruction manual ...
-
bioRxiv - Cancer Biology 2021Quote: ... Rabbit-Mouse kit (Dako, Denmark). Sections were counterstained with haematoxylin (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-mouse Desmin (Dako, M0760), anti-rabbit TDP43 (Proteintech ...
-
bioRxiv - Immunology 2021Quote: ... mouse anti-human CD3 (Dako) and mouse anti-HIV-1 P24 (Dako) ...
-
bioRxiv - Neuroscience 2020Quote: ... CD31 (1:100, mouse, Dako), Podocalyxin (1:200 ...
-
bioRxiv - Biochemistry 2020Quote: ... HRP-anti-mouse (Dako, P0260), HRP-anti-rabbit (Dako ...
-
bioRxiv - Developmental Biology 2022Quote: ... mouse anti-Ki67 (M7240, Dako); rabbit anti-Ki67 (RM-9106 ...
-
bioRxiv - Neuroscience 2020Quote: ... or α-mouse-HRP (Dako) (1:10000 ...
-
bioRxiv - Immunology 2020Quote: ... mouse IgG1 (Dako, Carpinteria, CA)] ...
-
bioRxiv - Molecular Biology 2019Quote: ... and anti-mouse (Dako; P0161). Protein bands were visualized using Pierce ECL western blotting substrate (Thermo) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Monoclonal mouse IgG1 antibody (DAKO) served as the negative control ...
-
bioRxiv - Neuroscience 2019Quote: ... NSE (Dako, mouse, 1:1,000), GFAP (Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: ... CD68 (mouse monoclonal PGM1, Agilent M087601-2 ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse monoclonal anti-aSMA (DAKO), mouse monoclonal anti-Cas9 (Cell signaling) ...
-
bioRxiv - Genetics 2020Quote: ... Sigma Aldrich)/goat anti-mouse (P0447, Dako) as a loading control.
-
bioRxiv - Neuroscience 2022Quote: ... anti–mouse desmin (Dako; M0760), anti–rabbit DNAJB6 (Abcam ...
-
bioRxiv - Cell Biology 2022Quote: ... Anti-mouse Envision system (Dako) was used for secondary detection ...
-
bioRxiv - Cell Biology 2022Quote: ... Anti-mouse Envision system (Dako) was used for secondary detection ...
-
bioRxiv - Genetics 2022Quote: ... anti-mouse Desmin (Dako, M0760), anti-rabbit DNAJB6 (Abcam ...
-
bioRxiv - Physiology 2022Quote: ... Monoclonal mouse IgG1 antibody (DAKO) served as the negative control ...
-
bioRxiv - Cancer Biology 2024Quote: ... CD1a (Mouse 010, DAKO, M3571) for LCs ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse anti-human CD8 (DAKO), and mouse anti-human TAG72 (AB16838 ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse anti-human CD3 (DAKO), mouse anti-human CD4 (DAKO) ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse anti-human CD4 (DAKO), mouse anti-human CD8 (DAKO) ...
-
bioRxiv - Neuroscience 2023Quote: ... or goat anti-mouse (Dako). The protocol is described in detail in the Supplemental Methods.
-
bioRxiv - Cancer Biology 2023Quote: ... Rabbit-Mouse kit (Dako, DK). Sections were counterstained with haematoxylin (Sigma-Aldrich Inc.) ...
-
bioRxiv - Cancer Biology 2023Quote: ... including anti-mouse (Dako, P0260) and anti-rabbit (Sigma ...
-
bioRxiv - Genetics 2023Quote: Mouse anti-p53 (M7001, DAKO)
-
bioRxiv - Immunology 2023Quote: ... rabbit anti-mouse-HRP (DAKO) or rabbit anti-goat (Abcam) ...