Labshake search
Citations for Agilent :
251 - 300 of 501 citations for Rat TRPV1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... the plasmid was transformed into BL21-Gold (DE3) competent cells (Agilent Technologies, Santa Clara, CA, USA) and inoculated onto LB agar plate supplemented with 50 ug/ml kanamycin.
-
bioRxiv - Biophysics 2023Quote: ... The WT and high-specificity Rec3 plasmids were transformed into BL21-Gold (DE3) competent cells (Agilent) and expressed in lysogeny broth (LB ...
-
bioRxiv - Microbiology 2023Quote: ... Mutagenesis of the different plasmids was achieved using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent). All plasmids were freshly transformed into the appropriate strains before each of the experiments.
-
bioRxiv - Bioengineering 2023Quote: ... In silico assembly and de novo synthesis of transformation plasmids using pBluesript II KS (+) (Stratagene, USA) as the backbone vector was done in the Snapgene (software v ...
-
bioRxiv - Biochemistry 2023Quote: ... SUV420H1 plasmid was transformed into Escherichia coli BL2-codon plus (DE3)-RIL competent cells (Agilent technologies) and grown in 2xYT-Kan media ...
-
bioRxiv - Biochemistry 2023Quote: ... The BDF1 point mutant plasmids were obtained using the QuikChange II Site-directed mutagenesis kit (Agilent) with the BDF1 plasmid pJG267 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV plasmids were packaged into AAV serotype 9 using the AAV Helper-Free system (Agilent Technologies). In brief ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV plasmids were packaged into AAV serotype 9 using the AAV Helper-Free system (Agilent Technologies). In brief ...
-
bioRxiv - Biochemistry 2023Quote: ... Mutagenesis of the plasmids was performed with the indicated primers (Table S4) using PfuTurbo Polymerase (Agilent) followed by DpnI (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... H3.3 mutations were introduced into the pBabePuro dH3.3-IRES GFP plasmid using site-directed mutagenesis (Agilent). Plasmids were verified by sequencing ...
-
bioRxiv - Cell Biology 2023Quote: ... The P878A mutation was generated from the WT plasmid using the Quikchange Lightning mutagenesis kit (Agilent) and primers (CCTAGGCCTCCACCAGCAGAGGAAAAGGATG ...
-
Sex and species associated differences in Complement-mediated immunity in Humans and Rhesus macaquesbioRxiv - Immunology 2023Quote: ... Mutations in the wild type heavy chain plasmid were performed using site directed mutagenesis (Agilent, 200524) following the manufacturer’s protocol to generate EG ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Immunodetection was carried out by blocking PVDF membranes in 5% (w/v) fat-free dried milk powder followed by incubation overnight in rat anti-FLAG antibodies diluted 1:500 (Agilent Technologies, Santa Clara, CA, USA). After a brief rinse in Tris-buffered saline with Tween™ 20 detergent (TBST) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... the homology arms containing plasmid was mutated using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, #200522) to delete the single-guide RNA (sgRNA ...
-
bioRxiv - Microbiology 2020Quote: ... C-terminal flag tag (DYKDDDDK) was added to pHH21-NA encoding plasmids via site directed mutagenesis (Agilent). cDNA was generated from the pHH21-NA flag plasmids with Q5 Hot-Start PCR (NEB) ...
-
bioRxiv - Biophysics 2020Quote: ... a point mutation was introduced into the WT plasmid using the QuikChange site-directed mutagenesis method (Agilent). HEK-293 cells were transiently transfected with NaChBac WT or T220A cDNA using Lipofectamine™ 2000 transfection reagent (Invitrogen ...
-
bioRxiv - Biochemistry 2022Quote: ... The required vector was transformed into Escherichia coli BL21 (DE3) cells containing the RIL Camr plasmid (Stratagene) for expression analysis.
-
bioRxiv - Microbiology 2022Quote: ... and were used to PCR amplify around the pMMB67EH plasmid using PfuUltra II high-fidelity polymerase (Agilent). PCR products were purified (QIAGEN ...
-
bioRxiv - Biophysics 2019Quote: ... Histone expression plasmids were from Narlikar lab and BL21(DE3)pLysS competent E.coli cells were from Agilent Technology (USA) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... point mutations were introduced in the pIRES2-mCherry-YFPCFTR plasmid using site-directed mutagenesis (Quikchange protocol, Stratagene).
-
bioRxiv - Cell Biology 2019Quote: Generation of pGDB-SDEL plasmid was done using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) on the pGDB plasmid with primers P1 and P2 per the manufacturer’s protocol36.
-
bioRxiv - Microbiology 2021Quote: ... berghei gDNA using primers 9483/9484 and 9485/9486 respectively and introduced sequentially into pBSKS+ plasmid (Stratagene) at XhoI/BamHI and EcoRI/SacII restriction sites respectively ...
-
bioRxiv - Biophysics 2022Quote: ... Site-directed mutagenesis were introduced into plasmids using QuikChange II XL site-directed mutagenesis kit (Agilent Technologies) and confirmed by Sanger sequencing.
-
bioRxiv - Microbiology 2022Quote: Plasmids were isolated from 250 mL cultures of Escherichia coli (XL10-Gold Ultracompetent Cells, Agilent Cat. 200314) and 60 μg of each plasmid was used to transfect ring stage parasites ...
-
bioRxiv - Neuroscience 2022Quote: ... The pT7-7 plasmid was also modified using site directed mutagenesis (#200523, QuikChange II, Agilent, Waldbronn, Germany) to incorporate a cysteine residue at position 141 to permit dye-labelling of the aSyn protein ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Plasmid and cDNA libraries were pooled and quality was evaluated using capillary gel electrophoresis (Agilent Bioanalyzer 2100). Sequencing was performed on an Illumina HiSeq 1500 instrument using a single-index ...
-
bioRxiv - Cell Biology 2023Quote: ... I5S mutant (mt) RIIα-mTb-V5 plasmid was generated by site directed mutagenesis (QuikChange II XL, Agilent) based on the wild type (WT ...
-
bioRxiv - Developmental Biology 2023Quote: ... and the fragments were incorporated into a pBluescript II SK (−) vector plasmid (Agilent Technologies Japan, Hachioji, Japan). Start codon mutant constructs were generated by mutation PCR using the PrimeSTAR Mutagenesis Basal Kit (Takara Bio ...
-
bioRxiv - Microbiology 2023Quote: Plasmids were isolated from 250 mL cultures of Escherichia coli (XL10-Gold Ultracompetent Cells, Agilent Cat. 200314) and 60 µg of pDC2-MORC-HA or linearized pKD-MORC-HA-TetR-DOZI ...
-
bioRxiv - Neuroscience 2023Quote: ... The mutation A243V was introduced into the GluN2A plasmid using the QuickChange II XL kit from Agilent. All portions of the resulting construct that were subject to PCR were confirmed by DNA sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... Site-directed mutagenesis on the pmPol I-LASV Sag plasmid was performed using QuikChange II kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: The Nir1-LNS2 plasmid was transformed into competent BL21 (DE3) RIPL cells (Agilent Technologies, Cat. No. 230280) for protein overexpression ...
-
bioRxiv - Genetics 2021Quote: ... cloned into an expression plasmid driven by CMV promoter and modified using QuikChange Site-Directed Mutagenesis Kit (Agilent). For each affinity purification ...
-
bioRxiv - Immunology 2019Quote: Mutations were introduced into plasmid constructs using the QuickChange Site-Directed Mutagenesis Kit (Agilent Technologies, San Jose, CA) as recommended by the manufacturer ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 34 plasmids encoding new quantification tag (LVXXLTK) were amplified using PfuUltra II Fusion HS DNA Polymerase (Agilent Technologies) using appropriate DNA primers (Table S7) ...
-
bioRxiv - Cell Biology 2021Quote: ... The pST39-BLOC-1 plasmid encoding recombinant BLOC-1 was transformed into BL21gold(DE3)plysS cells (230134, Agilent). Several colonies from the plate were inoculated into a starter culture of 10 ml LB supplemented with 34 μg/ml chloramphenicol and 100 μg/ml ampicillin that was grown overnight at 37 °C with moderate shaking ...
-
bioRxiv - Microbiology 2020Quote: ... S27 isolate-based plasmid via site-directed mutagenesis using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies). The following mutations were introduced ...
-
bioRxiv - Microbiology 2021Quote: ... plasmid was reacted with primer pairs designed to introduce the desired mutations using Quikchange kit (Agilent, cat# 600670). After digestion with the restriction enzyme DpnI (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... IN mutations were introduced in the pLR2P-VprIN plasmid using the QuikChange Site- Directed Mutagenesis kit (Agilent Technologies). The presence of the desired mutations and the absence of unwanted secondary changes was assessed by Sanger sequencing.
-
bioRxiv - Microbiology 2019Quote: ... IN mutations were introduced into the pLR2P-vprIN plasmid using the QuickChange Site-Directed Mutagenesis kit (Agilent Technologies). Presence of the desired mutations and absence of unwanted secondary changes were verified by Sanger sequencing.
-
bioRxiv - Immunology 2019Quote: ... R148Q mutation was generated by site-directed mutagenesis on a WT STAT2 plasmid using QuickChange II PCR (Agilent). Lentiviral particles were generated by co-transfection of STAT2 ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmids were then transformed into XL-10 Gold chemically competent Escherichia coli cells (Agilent Technologies, Santa Carla, CA) as previously described [14] ...
-
bioRxiv - Microbiology 2022Quote: ... Site-directed mutagenesis of these plasmids for C483A or Pol(-) mutants were obtained with the QuikChange kit (Stratagene) using primers listed in Supplementary Table 1 ...
-
bioRxiv - Cell Biology 2019Quote: ... the pMTT1-GFP-LF4A plasmid was subjected to site-directed mutagenesis using the QuikChange Lightning kit (Agilent 210518) with the primers 5’-CAGGACGTTTGGCACTAGTGGCTGAATTGATGGATCAGAACC-3’ and 5’-GGTTCTGATCCATCAATTCAGCCACTAGTGCCAAACGTCCTG-3’.
-
bioRxiv - Microbiology 2020Quote: ... The plasmid for production of (His)6-SUMO-σAntA-DD was generated by site-directed mutagenesis (Agilent QuikChange) using primers listed in Table S3 ...
-
bioRxiv - Microbiology 2021Quote: ... Mutations were introduced to the M plasmid using the QuikChange Lightning site-directed mutagenesis (Agilent, Santa Clara, CA) protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... Introducing stop codon at residue 561 in pCS2-Hs BMP2K plasmid using QuikChange site-directed mutagenesis (Agilent Technologies) yielded pCS2-Hs BMP2KΔCT ...
-
bioRxiv - Immunology 2021Quote: A pAAV-MCS plasmid containing inverted terminal repeats (ITRs) from AAV serotype 2 (Agilent Technologies, Santa Clara, CA) was utilized as backbone for AAV6 plasmid construction (naturally occurring AAV6 has an AAV2 ITR (24)) ...
-
bioRxiv - Biophysics 2022Quote: ... A plasmid to express the T238V mutation of Tub2p (yeast β-tubulin) was made by QuikChange mutagenesis (Stratagene), using an expression plasmid for wild-type Tub2 as template and with primers designed according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2022Quote: A plasmid encoding 6xHis-tagged methionyl-tRNA synthetase (MetRS) was transformed into BL21 (DE3) Codon+ RIL cells (Agilent). Overnight cultures were diluted (1:100 ...