Labshake search
Citations for Agilent :
251 - 300 of 4135 citations for 4' Trifluoromethoxy 5 trifluoromethyl 1 1' biphenyl 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... GFAP (Biolegend, 829401, 1:1500 and Dako, Z0334, 1:1500), Nestin (Aveslabs ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1:1000, ab183741, abcam; n-Myc: 1:500, 51705 Cell Signaling Technology; CD45: 1:1000, 70257 Cell Signaling Technology; CD3: 1:2000 A0452 Dako/Agilent) diluted in TBST+5% goat serum in a humid chamber overnight at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were incubated with the required primary antibody (ABri: 338 1:1000 from Ghiso lab; ADan: 5282 1:1000 from Ghiso lab; CD68: 1:150 DAKO; CR3/43: 1:100 DAKO) for 1 hour at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... Library quality was confirmed by Agilent 2200 TapeStation nucleic acids system (Agilent) using the Agilent High Sensitivity D1000 DS DNA kit ...
-
bioRxiv - Molecular Biology 2020Quote: ... Library quality was confirmed by Agilent 2200 TapeStation nucleic acid system (Agilent) using the Agilent High Sensitivity D1000 DS DNA kit ...
-
bioRxiv - Biochemistry 2023Quote: ... Medronic acid was purchased from Agilent Technologies (Santa Clara).
-
bioRxiv - Cancer Biology 2021Quote: ... Sections were developed with 3′3-diaminobenzidine (DAKO Cytomation), following the manufacturer’s instructions.
-
bioRxiv - Physiology 2021Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation.
-
bioRxiv - Neuroscience 2021Quote: ... Retinoid analyses were performed using normal phase Zorbax Sil (5 mm, 4.6 3 150mm) column (Agilent Technologies, Santa Clara, CA, USA). The retinoids were eluted by step-wise gradient starting with 0.5% ethyl acetate in hexane over 15 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Bioengineering 2023Quote: ... at 40°C with an InfinityLab Poroshell 2.7 µM EC-C18 pre- column (3 x 5 mm; Agilent Technologies, Waldbronn, Germany) was used ...
-
bioRxiv - Bioengineering 2024Quote: ... two-channel 100 µm z-stack images were taken every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Bioengineering 2022Quote: ... Two-channel 54.8 μm z-stack images were taken every 3 hours for 45 hours after co-culture was initiated using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Immunology 2021Quote: ... The membranes were washed and incubated with rabbit anti-goat IgG (500 ng ml−1, 5% milk in PBST; Dako, P044901-2), rabbit anti-mouse IgG (1.3 μg ml−1 ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were counterstained with DAPI (1:1000 in 1X PBS) for 5 min and coverslipped with fluorescent mounting medium (#S3023, DAKO, Jena, Germany). Images were obtained using an Axioplan M2 fluorescent microscope (Zeiss ...
-
bioRxiv - Molecular Biology 2022Quote: ... at 37°C for 1 hour followed by vehicle or TGF-β (5 ng/ml) and 3000 cells were seeded into Seahorse assay microplates (Agilent Technologies). After 24h of incubation ...
-
bioRxiv - Molecular Biology 2024Quote: ... then spectrometry readings were collected every 5 min for 1 h using a BioTek Epoch microplate spectrophotometer (Agilent Technologies, Santa Clara, CA).
-
bioRxiv - Neuroscience 2024Quote: OCR assay: Cells were washed and incubated for 1 hour with 180 μL assay medium [in mmol/L: 5 glucose (Agilent #103577-100), 1 pyruvate (Agilent #103578-100) ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed four times for 5 min each in TBST and incubated with Polyclonal goat anti-mouse (P044701, Agilent, 1:2500) or anti-rabbit (P044801 ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were blocked for with 5% BSA for 1h prior to immunofluorescence staining performed as in (Clément et al., 2018) with PCNA antibody (DAKO, M879, 1:1000). We detected EdU using the Click-iT EdU Cell Proliferation kit as described in (Gatto et al. ...
-
Retinal affectation in Huntington’s disease mouse models concurs with a local innate immune responsebioRxiv - Neuroscience 2023Quote: ... and incubated overnight in a humid chamber at 4°C with rabbit anti-glial fibrillary acidic protein (GFAP) antibody (1:500, Z0334, DAKO, Agilent, Glostrup, Denmark), rabbit anti-ionized calcium binding adaptor molecule 1 (Iba-1 ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were incubated for 1h at RT before overnight incubation at 4°C with primary antibodies: Glial Fibrillary Acidic Protein (GFAP) (1/500 Dako Cat. Number Z0334); AQP4 (1/500 ...
-
bioRxiv - Neuroscience 2023Quote: ... Afterwards the sections were incubated in a humidified chamber (overnight 4°C) in a peroxidase conjugated immunoglobulin against UEA (DAKO, P289; 1:50). Finally ...
-
bioRxiv - Bioengineering 2024Quote: ... The solvent was then diluted with water (DMSO:water = 1:4) and subjected to purification through preparative reverse-phase HPLC chromatography (Agilent 1260 Infinity II HPLC). The chromatographic separation was carried out on an Agilent Prep-C18 column (250 mm × 21.2 mm × 10 μm ...
-
bioRxiv - Bioengineering 2024Quote: ... The solvent was then diluted with water (DMSO:water = 1:4) and subjected to purification through preparative reverse-phase HPLC chromatography (Agilent 1260 Infinity II HPLC). The chromatographic separation was carried out on an Agilent Prep-C18 column (250 mm × 21.2 mm × 10 μm ...
-
bioRxiv - Neuroscience 2024Quote: ... they were incubated overnight at 4°C with the respective primary antibodies: (i) polyclonal rabbit anti-GFAP (1:2000; Dako, Cat. No. Z0334); (ii ...
-
bioRxiv - Bioengineering 2024Quote: ... The solvent was then diluted with water (DMSO:water = 1:4) and subjected to purification through preparative reverse-phase HPLC chromatography (Agilent 1260 Infinity II HPLC). The chromatographic separation was carried out on an Agilent Prep-C18 column (250 mm × 21.2 mm × 10 μm ...
-
bioRxiv - Molecular Biology 2021Quote: ... anti-human prealbumin/TTR (1:1000, 2.0 g L−1, Dako), anti-DNAJB11/ERdj3 (1:1000 ...
-
bioRxiv - Bioengineering 2022Quote: ... and Vimentin (1:5000 Dako, Ref M0725, Clone V9, 1:5000) were similarly outsourced to Veterinary Diagnostic Services ...
-
bioRxiv - Molecular Biology 2022Quote: ... and mouse monoclonal Ki-67 (1:200, MIB-1, DAKO, Denmark). The secondary antibodies were donkey anti-rabbit IgG conjugated to Alexa Fluor 488 ...
-
bioRxiv - Immunology 2021Quote: ... or Allphycocyanin-labeled streptavidin (1:200 dilution, Agilent, Cat #PJ27S-1). Cells were washed once with FACS buffer ...
-
bioRxiv - Immunology 2020Quote: ... MPO (Dako; Cat. No. A0398 at 1:1000 for 1 hour), pSTAT3 (Cell Signaling ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-human prealbumin/TTR (1:1000, 2.0 g L−1, Dako), anti-DNAJB11/ERdj3 (1:1000 ...
-
bioRxiv - Immunology 2023Quote: ... 1 μM antimycin and 1 μM rotenone (Agilent, Cat# 103708-100) sequentially ...
-
Sex and species associated differences in Complement-mediated immunity in Humans and Rhesus macaquesbioRxiv - Immunology 2023Quote: ... 37 µL of 1:500 SA-PE (Agilent Technologies, PJ31S-1) was added as a detection agent ...
-
bioRxiv - Immunology 2022Quote: ... MPO (Dako; Cat. No. A0398 at 1:1000 for 1 hour), Iba-1 (BioCare ...
-
bioRxiv - Cell Biology 2024Quote: ... and Goat Anti-Rabbit HRP (Dako, P0448, 1:5000 – 1:20,000).
-
bioRxiv - Biochemistry 2024Quote: ... 1 µM dNTP mixture and 1 unit Herculase II polymerase (Agilent 600679 ...
-
bioRxiv - Immunology 2024Quote: ... 15 mM acetic acid and 2.5 µM medronic acid (5191–4506, Agilent Technologies, Santa Clara, CA, USA). The LC gradient was ...
-
bioRxiv - Microbiology 2021Quote: ... All other synthetic or expressed peptide substrates were purified and analyzed at small scale utilizing analytical-scale reverse-phase HPLC on an Agilent 1100 series HPLC system (Santa Clara, CA) employing an Eclipse Plus C18 column (5 μm, 4 × 150 mm) (Agilent) at a flow rate of 1 mL/min ...
-
bioRxiv - Pathology 2023Quote: ... Sections from the first level (main experiment) were stained for smooth muscle alpha-2 actin (ACTA2) and galectin 3 (LGALS3) using mouse monoclonal anti-ACTA2 (Dako, cat. no. M0851, 1:100) after blocking with Fab fragment (Jackson ImmunoResearch ...
-
bioRxiv - Bioengineering 2024Quote: ... and reverse primer (5’-AGGTCATGTACTGGGCATAAT-3’) binding to the GFP sequence with 5 µL of Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies, USA) and 0.15 µL of 2 µM reference dye.
-
bioRxiv - Molecular Biology 2024Quote: Serial sections of human and mouse FFPE BM biopsies were prepared at 3-5 μm thickness on coated microscope slides (Dako FLEX, Agilent) and processed for immunohistochemistry/immunofluorescent-based (IHC-IF) ...
-
bioRxiv - Neuroscience 2022Quote: ... Abcam; mouse anti-BrdU, 1:100,BD Biosciences; mouse anti-Nestin, 1:300, Millipore; rabbit anti-GFAP, 1:400, Dako; rabbit anti-Ki67 ...
-
bioRxiv - Neuroscience 2023Quote: ... 338 1:1000 from Ghiso lab; ADan: 5282 1:1000 from Ghiso lab; CD68: 1:150 DAKO; CR3/43: 1:100 DAKO) for 1 hour at room temperature ...
-
bioRxiv - Genomics 2023Quote: ... slides were deparaffinized and automatically stained with specific antibodies against synovial cell markers (PECAM-1, DAKO JC/70a, 1:10; CD20, Ventana Roche L26, prediluted; CD3, Leica LN10, 1:500; CD68, DAKO A/S PG-M1 ...
-
bioRxiv - Neuroscience 2024Quote: ... Every fourth section from approximately bregma −1.40 mm to −2.00 mm were immunostained with ionized calcium binding adaptor molecule 1 (Iba1; 1:2000; FUJIFILM Wako) and glial fibrillary acidic protein (GFAP; 1:1000; Dako); 4-6 sections per brain ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Cytokeratin 5/6 (mouse monoclonal) at 1:100 to 1:200 dilution for zebrafish tissue and 1:100 dilution for human tissue (Dako), GATA 3 (SAB2100898 ...
-
bioRxiv - Cell Biology 2020Quote: ... Germany) followed by overnight incubation at 4 °C with specific primary antibodies: polyclonal rabbit anti-human AAT (1:800) (DAKO A/S, Glostrup, Denmark), mouse monoclonal anti-AAT polymer antibody (clone 2C1 ...
-
bioRxiv - Neuroscience 2020Quote: ... and incubated overnight at 4°C in primary antibody (2% NGS in TBST) with either rabbit anti-GFAP (1:2000, Agilent Cat# Z0334, RRID: AB_10013382), rabbit anti-synaptophysin (IgG ...