Labshake search
Citations for Agilent :
201 - 250 of 4135 citations for 4' Trifluoromethoxy 5 trifluoromethyl 1 1' biphenyl 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Protein immunodetection was performed with primary abs diluted in blocking solution during overnight incubation at 4°C: rabbit polyclonal ab against alpha-1-antitrypsin (A0012, Dako, Agilent) at a 1:500 dilution ...
-
bioRxiv - Cell Biology 2020Quote: ... The Samples were diluted 4 fold with water and 1 μl supernatant was loaded on a Bioanalyzer High Sensitivity DNA electrophoresis chip (Agilent Technologies).
-
bioRxiv - Zoology 2020Quote: ... hydrated through graded ethanol and incubated overnight at 4°C with a mouse anti-human CD68 clone KP1 monoclonal antibody (1:100, Dako, Denmark). Then ...
-
bioRxiv - Immunology 2024Quote: A total of 10 µg/ml rHA were coated on an ELISA plate at 4 °C ON and afterwards incubated with rabbit anti-HA antibody (1:2000 dilution) (Dako, A0001) 2h at RT ...
-
bioRxiv - Cell Biology 2024Quote: hAC were fixed with 4% formalin and blocked for 1 h at 37°C (Protein-Block serum free, X0909 Dako Agilent). COL2 antibody (MA5-13026 ...
-
bioRxiv - Immunology 2023Quote: ... pH 7.4) for 1 h without CO2 prior to measurement of O2 consumption and extracellular acidification rate (ECAR) by XFe24 (Seahorse Bioscience) with sequential addition of 1 μM of oligomycin ...
-
bioRxiv - Immunology 2024Quote: ... the cells were washed once with PBS-EDTA and fixed with 1% paraformaldehyde before FACS analysis with a 4-laser (405, 488, 561 and 637 nm) Quanteon Novocyte (Agilent Technologies).
-
bioRxiv - Molecular Biology 2024Quote: ... After incubation the cells were fixed in 4 % PFA and stained with rabbit anti human C3c FITC (1: 100 Dako F020102) antibody ...
-
bioRxiv - Immunology 2022Quote: ... Reactions were stopped by adding 50 μL 3M hydrochloric acid and absorbance at 492 nm was determined on a Synergy 4 plate reader (BioTek, Agilent Technologies inc., CA, USA) or similar ...
-
bioRxiv - Neuroscience 2020Quote: ... GFAP (1:200, rabbit, Dako; 1:1000, chicken, Millipore), MBP (1:500 ...
-
bioRxiv - Pathology 2020Quote: ... anti-HER2 (1:400 to 1:600, DAKO, Denmark), anti-PR antibody (DAKO ...
-
bioRxiv - Biochemistry 2022Quote: ... All libraries at this step yielded >300,000 colonies implying a 100x coverage (assuming 1/3 of the variants were perfect based on our previous analysis of Agilent OLS based libraries). Each sublibrary was combined at an equimolar ratio to make a complete library with all intended mutations included.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Primary antibodies were diluted 1:4000 for anti-sGCα1 and 1:2000 for anti-sGCβ1 antibody in 3% dry milk in TBST and incubated with nitrocellulose membranes at 4°C over-night following challenge of membranes with secondary goat anti-rabbit antibody (1:2000 in 3% milk in TBST) conjugated to horseradish peroxidase (Dako A/S, Denmark). Immuno-complexes were visualized using an enhanced chemiluminescence kit (Amersham Pharmacia Biotech ...
-
bioRxiv - Biochemistry 2022Quote: 50 μL of pure CrRPE1 concentrated at 9.5 mg mL−1 were injected on BioSEC-3 300 size-exclusion chromatography column (Agilent Technologies, Santa Clara, USA) equilibrated in buffer 20 mM Tris-HCl (pH 7.9 ...
-
bioRxiv - Immunology 2024Quote: ... The antigens on the slides were retrieved by submerging slides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent, Cat# S2375) and incubating at 97 °C for 40 min in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2020Quote: Per2AS variant 2 overexpression plasmid was generated from 5’RACE and 3’RACE products that were cloned in to pBluescript (Agilent), as well as Per2AS qPCR product cloned into pGEM-T (Promega) ...
-
bioRxiv - Genetics 2021Quote: ... Additional sequences were added to the 5’ (ACTGGCCGCTTGACG-) and 3’ (-CGCAGGAGCCGCAGTG) ends of each fragment and synthesized in a 100K pool by Agilent Technologies (Supplementary Table S2) ...
-
bioRxiv - Biochemistry 2020Quote: ... Selected mRNAs were purified and reverse-transcripted into single-chain DNA with the primer 5’-CTTCAGTTGCCGCTTTCTTTCTTG-3’ using a reverse transcriptase (Cat 200436, Agilent). The resulting cDNA library was purified using a DNA purification kit (Cat A740609.25 ...
-
bioRxiv - Cell Biology 2020Quote: ... were changed to 5′-ACCTGCAAAG −3′ by using the Quick-Change site directed mutagenesis Kit (Stratagene, La Jolla, CA, USA). Expression vectors for SENP2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... pCS2+-5’HA-sobp and pCS2+-sobp-3’HA were generated using the QuikChange lightning Site-directed mutagenesis kit (Agilent). The same kit was used to sequentially remove three nucleotides located at the 5’ end of the pCS2+-3’HA-sobp ORF to generate a construct whose transcribed mRNA does not bind to the designed translation-blocking antisense morpholino oligonucleotide (pCS2+-sobpMOI-3’HA ...
-
bioRxiv - Microbiology 2020Quote: ... and ZIKV X1 C35G R (5’-GCCTGCTAGTCAGGCACAGCTTGGGGA-3’) were used with a QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) to introduce the X1 C10415G mutation into the p2-ZIKV plasmid ...
-
p97/VCP induces GLI1 to control XBP1-dependent endoplasmic reticulum stress transcriptional responsebioRxiv - Cancer Biology 2021Quote: ... The cells were washed 3 times with PBS for 5 min and then incubated with a secondary antibody: Flex-HRP (EnVision System, Dako) for 30 min and washed 3 times 5 min with PBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... USP47 catalytic domain was mutated by changing cysteine 177 into alanine (C177A) using the sense primer (5’-gtttgcaaaaggctattcaaataggcagtcattgcttggtttactagtcc-3’) using Quickchange Lightning Site-directed Mutagenesis Kit from Agilent technologies ...
-
bioRxiv - Bioengineering 2024Quote: ... and cells were imaged every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies) .
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... a mutant version of each of the hsdR1 had a unique BamHI site inserted by site directed mutagenesis of a C at position 1033 of hsdR1 to a G using oligonucleotide directed mutagenesis (5’-CATCAGAGACTTTTTTAGCGGATCCAACCTAAACAAAAAGAC-3’) (Quick-Change Lightning. Agilent). The mutated site is shown in bold and italics and the generated BamHI site is underlined ...
-
bioRxiv - Molecular Biology 2024Quote: Serial sections of human and mouse FFPE BM biopsies were prepared at 3-5 μm thickness on coated microscope slides (Dako FLEX, Agilent) and processed for immunohistochemistry/immunofluorescent-based (IHC-IF) ...
-
bioRxiv - Biochemistry 2024Quote: ... were kept in a 5°C autosampler prior to analysis and injected onto a reverse- phase Zorbax SB-C18 column (150×3 mm, 5 μm particle size, Agilent, Santa Clara ...
-
bioRxiv - Bioengineering 2024Quote: ... Bevacizumab-sensitive/resistant U87 cells were cultured identically to wild-type U87 cells.79 Cells were screened for mycoplasma every 3 – 4 months with the MycoSensor qPCR Assay Kit (Agilent Technologies).
-
bioRxiv - Bioengineering 2021Quote: ... 10-20 µl injection volume depending on protein concentration) were injected on a Poroshell 300SB-C8 column (5 µm, 300Å, 1×75mm IDxL; Agilent Technologies) at a flow rate of 100 µl/min using solvent A (0.1% formic acid and 0.05% trifluoroacetic acid in water ...
-
bioRxiv - Systems Biology 2021Quote: ... using an Aminex HPX-87H ion-exchange column operated at 60°C with 5 mM H2SO4 as the mobile phase with a flow rate of 0.6 mL min-1 (Agilent, Santa Clara). The OD660 was measured with a Jenway 7200 spectrophotometer (Jenway ...
-
bioRxiv - Molecular Biology 2021Quote: ... approximately 8 µg of protein was injected on a Zorbax 300SB-C18 column (5 µm, 300Å, 1×250mm IDxL; Agilent Technologies) and separated using a 30 min gradient from 5% to 80% solvent B at a flow rate of 100 µl/min (solvent A ...
-
bioRxiv - Immunology 2021Quote: ... sections were washed three times in 1 X PBS for 5 minutes and the sections allowed to dry slightly before mounting with DAKO mounting medium (Agilent Technologies) and allowing to airdry overnight in the dark at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... approximately 2 µg of protein was injected on a Zorbax Poroshell 300SB-C8 column (5 µm, 300Å, 1×75mm IDxL; Agilent Technologies) and separated using a 15 min gradient from 5% to 80% solvent B at a flow rate of 100 µl/min (solvent A ...
-
bioRxiv - Cell Biology 2023Quote: ... frozen femur sections were blocked with 3% BSA and 5% goat serum in PBS, incubated with Cgrp antibody (rabbit polyclonal, abcam #ab47027, 1:300 in DAKO antibody diluent (Agilent, #S0809)) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were washed a further 3 times in TBS-T for 5 minutes and developed with DAB diluted at a 1:50 ratio in DAB-chromagen (Agilent; #K3468) until appearance of brown staining ...
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were washed three times with 1x PBST for 5 min and incubated with secondary antibodies anti-mouse-HRP (1:10,000) (Agilent Dako, #P0447) and anti-rabbit-HRP (1:10,000 ...
-
bioRxiv - Immunology 2024Quote: ... followed by three washes for 5 minutes each with PBS + 1% BSA at RT before mounting with DAKO fluorescent mounting medium (Agilent S3023) and imaging ...
-
bioRxiv - Cancer Biology 2024Quote: ... then triethylammonium phosphate monobasic solution - CH3CN to 100:0 in 5 min with a flow rate of 1 mL/min (Column: Zorbax SB-Aq 5 µm analytical column, 50 X 4.6 mm; Agilent Technologies, Inc). Method B ...
-
bioRxiv - Cancer Biology 2024Quote: ... then triethylammonium phosphate monobasic solution - CH3CN from 0:100 to 90:10 in 5 min with a flow rate of 1 mL/min (Column: Zorbax SB-Aq 5 µm analytical column, 150 X 4.6 mm; Agilent Technologies, Inc). Method C ...
-
bioRxiv - Cancer Biology 2024Quote: ... then triethylammonium phosphate monobasic solution - CH3CN from 20:80 to 80:20 in 10 min with a flow rate of 1 mL/min (Column: Zorbax SB-Aq 5 µm analytical column, 150 X 4.6 mm; Agilent Technologies, Inc). Peaks were detected by UV absorption (210 nm ...
-
bioRxiv - Developmental Biology 2022Quote: ... The PVDF membranes were blocked in 5 % nonfat dry milk diluted in Tris-buffered saline with 0.05 % Tween-20 for 1 h at room temperature and then incubated overnight at 4 °C with antibodies against FN (1:70000, rabbit anti-fibronectin, DAKO, Hamburg, Germany). After washing with TBS-T ...
-
bioRxiv - Molecular Biology 2022Quote: ... Adapter dilution (1:4) and PCR amplification (26 cycles) were optimized in a pilot experiment using Bioanalyzer DNA1000 (Agilent, Sant Clara, USA) chips as a read out of library size and quantity ...
-
Retinal affectation in Huntington’s disease mouse models concurs with a local innate immune responsebioRxiv - Neuroscience 2023Quote: ... and incubated overnight in a humid chamber at 4°C with rabbit anti-glial fibrillary acidic protein (GFAP) antibody (1:500, Z0334, DAKO, Agilent, Glostrup, Denmark), rabbit anti-ionized calcium binding adaptor molecule 1 (Iba-1 ...
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies (NeuN, 1:20,000, Millipore, MAB377B; CD68, 1:1,000, Serotec, MCA1957S; GFAP, 1:10,000, Dako Z0334) were diluted in 0.3% Triton X in PBS and incubated for 12 hours at RT ...
-
bioRxiv - Cancer Biology 2020Quote: ... CD21 (DAKO, 1:25, CD23 (Leica, CD23-1B12, 1:50), CD4 (DAKO ...
-
bioRxiv - Cancer Biology 2021Quote: ... mouse anti-Ki67 (1:50, clone MIB-1, Dako, M7240), mouse anti-INSR (1:50 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Anti-Ki-67 mouse (DAKO, clone MIB-1, 1:50); Anti-Ki-67 rabbit (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: ... GFAP (Biolegend, 829401, 1:1500 and Dako, Z0334, 1:1500), Nestin (Aveslabs ...
-
bioRxiv - Immunology 2023Quote: ... stained for H&E and HSV-1 (1:1000, Dako), and analyzed by a veterinary pathologist (Dr ...