Labshake search
Citations for Agilent :
251 - 300 of 1418 citations for 3 Hydroxy 20 oxo 5 pregnen 17alpha yl acetate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: 3μm thick FFPE sections were stained for CD8 (1:20, C8/144B, Dako) on a Roche Ventana autostainer ...
-
bioRxiv - Biochemistry 2021Quote: ... Tissue sections were revealed using 3,3’-diaminobenzidine (20 μl/ml, DAB, Dako, Spain) and counterstained with Carazzi’s hematoxylin ...
-
bioRxiv - Microbiology 2022Quote: ... with a 20 m 0.18mm (18μm film thickness) HP5MS capillary column (Agilent, USA). Helium was used as a carrier gas at a flow rate of 1 mL min−1 ...
-
bioRxiv - Microbiology 2021Quote: ... For digestion of proteins in the insoluble fraction 20 µl StrataClean beads (Agilent), which bound 20 µg protein ...
-
bioRxiv - Immunology 2023Quote: ... and anti-CD68/CD206 in a 1:20/1:100 dilution (Dako/Sigma). After washing ...
-
bioRxiv - Cell Biology 2023Quote: ... for 20 min and slides were mounted with Dako fluorescence mounting medium (Agilent).
-
bioRxiv - Neuroscience 2023Quote: ... and 72°C for 20 s using AriaMx Real-Time PCR System (Agilent). All primers (Table S1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... brain sections were pretreated with target retrieval solution (DAKO, 20 min, 95°C) prior incubation with the following primary antibodies overnight at 4°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were incubated with polyclonal goat anti-mouse FITC (DAKO F0479 1:20). Finally ...
-
bioRxiv - Molecular Biology 2024Quote: ... for 16-20 hours using a BioTek Microplate Reader (Agilent Technologies, United States). For experiments requiring double-stranded cfDNA ...
-
bioRxiv - Developmental Biology 2021Quote: ... The antigen retrieval was achieved with 3 min proteinase K treatment (S3020, Agilent), and the sections were washed in PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... both packed with Polaris C18-A 3-μm material (all from Agilent Corp.). After injection of the sample onto the trapping column ...
-
bioRxiv - Neuroscience 2020Quote: ... a 3-minute incubation in Envision FLEX Peroxidase-blocking Reagent (GV823, Agilent DAKO) was performed ...
-
bioRxiv - Neuroscience 2020Quote: ... a 3-minute incubation in Envision FLEX Peroxidase-blocking Reagent (GV823, Agilent DAKO) was performed ...
-
bioRxiv - Microbiology 2022Quote: ... Agilent SEC-3 300-Å HPLC column (Agilent Technologies, cat. no. 5190-2511) was used to purify tRNA from total RNA with a temperature-controlled column compartment at 40 °C with 100 mM ammonium acetate aqueous phase at a flow rate of 1 ml/min ...
-
bioRxiv - Developmental Biology 2021Quote: ... and all antibodies (Supplemental Table 3) diluted in antibody diluent solution (DAKO, S0809). Secondary staining was performed for 30 min ...
-
bioRxiv - Immunology 2020Quote: ... and backbone plasmid pNL4-3.Luc.R-E-(NIH AIDS Reagent) using GeneJammer (Agilent) in 10% FBS/DMEM enriched with 1% Pennicilin/Streptomycin (D10 medium) ...
-
bioRxiv - Immunology 2020Quote: ... For immunohistochemistry the antibodies detailed in follow were used: AE1/3 (Dako/IR053), TTF-1 (Dako/IR056) ...
-
bioRxiv - Cell Biology 2023Quote: ... washed 3×10 minutes with PBS again and mounted using glycergel (Dako, Cat.N.C0563). The imaging was performed with the use of ZEISS microscopes ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... For separation a Zorbax RRHD Eclipse XDB C18 column (1.8µm, 3×50mm; Agilent) was used ...
-
bioRxiv - Biochemistry 2024Quote: ... The column used was Bio-SEC-3 130 Å 4.6/300 (Agilent Technologies). All samples were run in 20 mM HEPES ...
-
bioRxiv - Microbiology 2024Quote: ... The size exclusion analytical column (Bio-SEC-3, Agilent, Santa Clara, CA, USA) was loaded with 50-µl of protein at a concentration of 3.0 mg/ml ...
-
bioRxiv - Immunology 2024Quote: ... with a guard column Zorbax Extend C18 (3 × 5mm, 1.8μm; Agilent, Waldbronn, Germany), both maintained at 60°C ...
-
bioRxiv - Cancer Biology 2024Quote: 3 µm thin TMA sections were mounted on Flex microscope slides (Agilent Technologies) and dried at room temperature (RT ...
-
bioRxiv - Cell Biology 2024Quote: ... 2.5 mM calcium chloride for 15 mins at RT prior to examining fluorescence on a Citation 5 microplate reader (Agilent-BioTek, Santa Clara, CA), exciting at 535 nm and measuring emission at 610 nm ...
-
bioRxiv - Plant Biology 2020Quote: ... tocochromanols in 20 μL of supernatant were separated by an HPLC 1100 system (Agilent Technologies ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.05% Tween-20) and incubated with HRP-conjugated secondary antibody (1:1500, #P0260, Agilent) for 1h at RT ...
-
bioRxiv - Immunology 2021Quote: ... washed twice with PBS/2% FCS and stained with PE (Prozyme, 20 µg/ml). RNA flow cytometry measurement of Bhlhe40 expression was performed using the PrimeFlow RNA Assay (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: Bioenergetics of washed platelets (20 × 106/well) were determined by Seahorse XFe96 (Agilent Technologies) as previously described (54) ...
-
bioRxiv - Bioengineering 2022Quote: ... using a HP-PLOT/Q column (30 m × 0.32 mm, 20 μm) from Agilent Technologies and nitrogen as the carrier gas ...
-
bioRxiv - Genomics 2022Quote: ... Sample showing a broad distribution of DNA 20-100 kbp on Femto Pulse (Agilent) was selected to proceed ...
-
bioRxiv - Developmental Biology 2023Quote: ... antigen retrieval was performed by boiling slides for 20 min in citrate buffer (Dako). Sections were incubated in primary antibody solution at the appropriate dilution overnight at 4°C ...
-
bioRxiv - Genomics 2021Quote: ... using 5 μL Fe(III)-NTA cartridges (Agilent, G5496-60085) according to the instructions of the manufacturer ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... Reverse primer: 5’GTTGCAGCATGTTTCAGATGAT3’ with paq polymerase 5000 (Agilent, USA) and resulting PCR products were electrophoresed on 3% agarose gel ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Mouse Anti-Enterovirus Clone 5-D8/1 (Dako M7064) to identify CVB VP1 region ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytokeratin 5/6 (mouse monoclonal, clone 6D5/16 B4, Dako), epidermal growth factor receptor (EGFR ...
-
bioRxiv - Pathology 2024Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). The fluorescence of SNARF-5F were measured in a time dependent manner using Synergy Neo2 (Agilent/BioTek ...
-
bioRxiv - Biophysics 2023Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). For the I-/Cl- antiport assay ...
-
bioRxiv - Cancer Biology 2022Quote: ... C18 cartridges (Agilent, 5 μL bead volume, 150 μg capacity) were primed using 100 μL of 90% acetonitrile and equilibrated with 70 μL of 0.1% TFA at 10 μL/min ...
-
bioRxiv - Bioengineering 2022Quote: Images were captured in Cytation 5 (Agilent, Santa Clara, CA) and processed with ImageJ (NIH ...
-
bioRxiv - Microbiology 2022Quote: ... Fluorescence was measured using a Cytation 5 plate reader (Agilent).
-
bioRxiv - Developmental Biology 2023Quote: ... A 30 m HP-5 MS UI (Agilent J&W) column (0.25 mm ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.3% Triton X-100 with 5% Goat Serum (Dako #X090710)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... anti-mouse-HRP at 5 µg/ml (Dako, Cat # P0447).
-
bioRxiv - Molecular Biology 2024Quote: ... The 5’-dimethoxytrityl group was retained for HPLC purification (Agilent PLRP-S column ...
-
bioRxiv - Microbiology 2024Quote: ... and the plates were read with a Cytation 5 (Agilent) plate reader ...
-
bioRxiv - Immunology 2024Quote: ... endogenous peroxidases were blocked for 5 minutes (Agilent, ref. SM801) and then the slides were incubated with CD8 antibody (Histosure ...
-
bioRxiv - Molecular Biology 2024Quote: ... which is 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases were 95% ultrapure water with 0.1% (v/v ...
-
bioRxiv - Molecular Biology 2024Quote: ... which was 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases were 95% ultrapure water with 0.1% (v/v ...
-
bioRxiv - Molecular Biology 2024Quote: ... which is 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases were 70% 10 mM ammonium sulfate and 30% methanol ...