Labshake search
Citations for Agilent :
51 - 100 of 1418 citations for 3 Hydroxy 20 oxo 5 pregnen 17alpha yl acetate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were washed 3 times (5 min) in TBST prior to addition of secondary antibody (goat anti-rabbit HRP 1:10,000; Dako - P00448). Blots were washed 3 times in TBST prior to development using SuperSignal West Pico Plus substrate (ThermoFisher ...
-
bioRxiv - Molecular Biology 2024Quote: Serial sections of human and mouse FFPE BM biopsies were prepared at 3-5 μm thickness on coated microscope slides (Dako FLEX, Agilent) and processed for immunohistochemistry/immunofluorescent-based (IHC-IF) ...
-
bioRxiv - Biochemistry 2024Quote: ... were kept in a 5°C autosampler prior to analysis and injected onto a reverse- phase Zorbax SB-C18 column (150×3 mm, 5 μm particle size, Agilent, Santa Clara ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Extracellular acetate concentration was determined with an Agilent 1200 HPLC system (Agilent Technologies, CA, USA) with a REZEX 8 μL 8% H+ organic acid column (300 ×7.8 mm ...
-
bioRxiv - Cancer Biology 2021Quote: ... Sections were developed with 3′3-diaminobenzidine (DAKO Cytomation), following the manufacturer’s instructions.
-
bioRxiv - Physiology 2021Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation.
-
bioRxiv - Neuroscience 2021Quote: ... Retinoid analyses were performed using normal phase Zorbax Sil (5 mm, 4.6 3 150mm) column (Agilent Technologies, Santa Clara, CA, USA). The retinoids were eluted by step-wise gradient starting with 0.5% ethyl acetate in hexane over 15 min ...
-
bioRxiv - Bioengineering 2022Quote: ... Two-channel 54.8 μm z-stack images were taken every 3 hours for 45 hours after co-culture was initiated using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Bioengineering 2024Quote: ... two-channel 100 µm z-stack images were taken every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Bioengineering 2023Quote: ... at 40°C with an InfinityLab Poroshell 2.7 µM EC-C18 pre- column (3 x 5 mm; Agilent Technologies, Waldbronn, Germany) was used ...
-
bioRxiv - Cancer Biology 2024Quote: ... 30 mM ammonium acetate (NH4Ac) (aq) + 0.1% formic acid (FA) + 0.0015% InfinityLab Deactivator (Agilent Technologies, Inc.) in 1% MeOH ...
-
bioRxiv - Microbiology 2024Quote: ... Filtered samples (0.22 nitrocellulose filter) were analyzed for glucose and acetate acid using HPLC (Agilent 1260) with a refractive index detector and with a reverse-phase column C18 (Waters ...
-
bioRxiv - Microbiology 2024Quote: ... Monosaccharides were converted conventionally into the alditol acetates analyzed by GLC on a Maestro (Agilent 7820) chromatograph (Interlab ...
-
bioRxiv - Microbiology 2024Quote: ... and partly methylated alditol acetates were analysed by GC-MS using a gas chromatograph (7890A, Agilent Technologies ...
-
bioRxiv - Genetics 2023Quote: ... Kallisto quant settings were adjusted to -b 5 -l 160 -s 20 - -single - -threads 4 based on fragment lengths determined by the Agilent 4200 TapeStation (Agilent Technologies, Inc.)
-
bioRxiv - Bioengineering 2024Quote: ... and reverse primer (5’-AGGTCATGTACTGGGCATAAT-3’) binding to the GFP sequence with 5 µL of Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies, USA) and 0.15 µL of 2 µM reference dye.
-
bioRxiv - Molecular Biology 2024Quote: Serial sections of human and mouse FFPE BM biopsies were prepared at 3-5 μm thickness on coated microscope slides (Dako FLEX, Agilent) and processed for immunohistochemistry/immunofluorescent-based (IHC-IF) ...
-
bioRxiv - Biochemistry 2020Quote: ... The samples were incubated for at least 20 min at 25°C before 10 μl were injected onto a SEC-3 HPLC column (300 Å pore size; Agilent Technologies, Santa Clara, CA) equilibrated with SEC buffer ...
-
bioRxiv - Immunology 2022Quote: ... Solid phase extraction was performed on methanol and sodium acetate conditioned Bond Elut Certify II cartridges (Agilent). After loading the samples ...
-
bioRxiv - Microbiology 2022Quote: ... The concentrations of acetate and ethanol were determined using a 7890A gas chromatograph (Agilent, Wilmington, DE, USA) equipped with a flame ionisation detector (Agilent ...
-
bioRxiv - Cancer Biology 2020Quote: ... blocked in 0.5% hydrogen peroxide for 5 minutes at room temperature and then blocked with 20% normal rabbit or goat serum (DAKO, Agilent, Cheadle, Cheshire, UK) for 20 min and incubated with the primary antibody overnight at +4°C ...
-
bioRxiv - Biochemistry 2021Quote: ... (N-acetyl)paenilamicin-containing fractions were concentrated and purified subsequently by using a Grace HPLC column (GROM-Sil 120 ODS-5-ST, 10 µm, 250 × 20 mm) coupled to an Agilent 1100 HPLC system (Agilent Technologies, Waldbronn, Germany) with a MWD UV detector ...
-
Dual MAPK and HDAC inhibition rewires the apoptotic rheostat to trigger colorectal cancer cell deathbioRxiv - Cancer Biology 2021Quote: ... Chromagen was developed using the DAB (3, 3-diaminobenzidine) reagent (Dako). Sections were counter-stained using pre-filtered Mayer’s haematoxylin (Amber Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Antigen–antibody complexes were revealed with 3-3’-diaminobenzidine (K3468, Dako). Sections were counterstained with haematoxylin (Dako ...
-
bioRxiv - Cell Biology 2020Quote: ... Antigen-antibody complexes were revealed with 3-3’-diaminobenzidine (K3468, Dako). Sections were counterstained with hematoxylin (Dako ...
-
bioRxiv - Physiology 2022Quote: ... Antigen–antibody complexes were revealed with 3-3′- diaminobenzidine (K346811, Dako) or the DAB (Polymer ...
-
bioRxiv - Cell Biology 2024Quote: ... at 1:500 and 3-3’-diamino-benzidine-tetrahydrochloride (Dako, K3468). Stained sections were imaged using an NanoZoomer 2.0HT (Hamamatsu).
-
bioRxiv - Cancer Biology 2024Quote: ... Antigen–antibody complexes were reveled with 3-3′-diaminobenzidine (K346811, Agilent). Sections were counterstained with hematoxylin (CS700 ...
-
bioRxiv - Pathology 2022Quote: ... in TRIS-acetate-EDTA (TAE) buffer or using an automated capillary electrophoresis system (2100 Bioanalyzer Instrument G2939BA, Agilent) using a kit assay (Agilent RNA 6000 Nano Kit 5067-1511 ...
-
bioRxiv - Cancer Biology 2022Quote: ... B=90% acetonitrile in water, both A and B containing 10mM ammonium acetate pH 9.0 and 5μM Agilent’s deactivator additive ...
-
bioRxiv - Microbiology 2021Quote: ... Tissue sections were colored via DAB-staining (3, 3-diaminobenzidine; Dako, K3468).
-
bioRxiv - Physiology 2022Quote: ... The first was a DB 5 column (20 m long x 0.18 mm internal diameter x 0.18 μm thick) (Agilent J & W Scientific, Folsom, CA, USA), and the second a Rxi-17 column (0.84 m long x 0.1 mm internal diameter x 0.1 μm thick ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’-Diaminobenzidine (DAB, Agilent) and then counterstained with haematoxylin (Abcam) ...
-
bioRxiv - Biophysics 2021Quote: ... and endogenous peroxidase was blocked with 3% H2O2 in TBS for 5 min followed by incubation with anti-mouse EnVision+ labelled polymer (Agilent Technologies, Santa Clara, USA) for 30 min ...
-
bioRxiv - Physiology 2021Quote: ... was amplified by PCR using cDNA of mouse kidney at the template with the primers 5′-CCGTCGACATGCAGGTCAAGAAATCCTG-3′ (SalI site in italics) and 5′-CCGGATCCTTAAAGGCGTGTGTGATCTT-3′ (M6 reverse primer; BamHI site in italics) and cloned into pBluescript SK(−) (Stratagene, La Jolla, CA, USA) using the SalI and BamHI sites ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... p-nitrophenyl acetate (pNPA) hydrolysis was determined using a SpectraMax Plus384 microplate reader (Agilent Technologies, Seoul, Republic of Korea). The cell lysates were transferred to a 96-well plate and reactions (0.2 mL final mixture volume ...
-
bioRxiv - Immunology 2020Quote: ... The partially methylated alditol acetates obtained were analyzed by GC-MS (Agilent 7890A GC interfaced to a 5975C MSD).
-
bioRxiv - Cancer Biology 2023Quote: ... in 3 cycles for 3 hours using the Seahorse XFe24 analyzer system (Agilent Technologies). Inhibitors and substrates were used at the following concentrations ...
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm column (Agilent), column temperature 50 °C ...
-
bioRxiv - Biochemistry 2023Quote: ... Fluorescence polarization filter cube (Green FP, EX 485/20 nm;EM 528/20 nm, Agilent) was used to measure polarization with the plate reader (Synergy Neo2 ...
-
bioRxiv - Microbiology 2024Quote: Acetate production was analyzed by high performance liquid chromatography (HPLC) using an Agilent 1100 Series (Agilent, Santa Clara, CA, USA), with a refractive index detector and an ion exclusion column (Rezex ROA - Organic Acid H+ ...
-
bioRxiv - Microbiology 2024Quote: ... The concentrations of acetate and ethanol in the supernatant were determined using a 7890A gas chromatograph (Agilent, Wilmington, DE, USA) equipped with a capillary column (ECTM-Wax ...
-
bioRxiv - Microbiology 2021Quote: ... and mobile phase B was 10 mM ammonium acetate at pH 9 in ultra-pure water with 12 μM medronic acid (InfinityLab Deactivator additive, Agilent Technologies). The flow rate was kept at 250 μl/ml consisting of a 2 minutes hold at 10% B ...
-
bioRxiv - Microbiology 2021Quote: ... and mobile phase B was 10 mM ammonium acetate at pH 9 in ultra-pure water with 15 μM medronic acid (InfinityLab Deactivator additive, Agilent Technologies). The flow rate kept at 250 μl/ml consisting of a 2 minutes hold at 10% B ...
-
bioRxiv - Microbiology 2022Quote: ... and mobile phase B was 10 mM ammonium acetate at pH 9 in ultra-pure water with 15 μM medronic acid (InfinityLab Deactivator additive, Agilent Technologies). The flow rate was kept at 250 μL mL−1 consisting of a 2 min hold at 10% B ...
-
bioRxiv - Microbiology 2024Quote: ... samples were harvested and prepared for an ethyl acetate extraction method as described previously (26, 43) for quantification with a gas chromatography-flame ionization detector (GC-FID, Agilent Technologies) fitted with an Agilent DB-WAX capillary column (15 m x 320 μm x 0.25 μm) ...
-
bioRxiv - Bioengineering 2024Quote: ... 5 µm (Agilent). Next ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-diaminobenzidine (DAB) solution (Dako, USA) until signal was detected ...
-
bioRxiv - Cancer Biology 2022Quote: ... and KI67 (clone TEC-3, Dako) were then incubated on the tissue slices and bound antibody was detected with biotinylated goat anti-rat IgG (Southern Biotechnology) ...