Labshake search
Citations for Agilent :
251 - 300 of 776 citations for 3 Chloro phenyl 9H fluoren 9 ylmethoxycarbonylamino acetic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm 2.7 μm HPLC column (Agilent) with a Poroshell 120 PFP ...
-
bioRxiv - Microbiology 2024Quote: ... anti-Cluster of Differentiation 3 (CD3; Agilent Dako), anti-Paired box protein-5 (Pax-5 ...
-
bioRxiv - Microbiology 2024Quote: ... anti-Cluster of Differentiation 3 (CD3; Agilent Dako), anti-Paired box protein-5 (Pax-5 ...
-
bioRxiv - Physiology 2022Quote: ... RNAs were extracted from n = 9 to 15 independent livers per group and RNA quality assessed using a TapeStation 4200 instrument (Agilent, Santa Clara, CA, USA). High quality RNA samples (RIN > 9.0 ...
-
bioRxiv - Biochemistry 2024Quote: ... 9 were collected with a 5500 Series spectrometer equipped with a diamond-ATR (attenuated total reflectance) sampling module (Agilent Technologies, Santa Clara, CA, USA). The signals were obtained with 8 cm-1 spectral resolution (unless specified otherwise ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the concentration of various organic acids were measured by HPLC (Agilent, 1260 Infinity), using a standard analytical system (Shimadzu ...
-
bioRxiv - Plant Biology 2022Quote: ... whereas the amino acids were quantified using an HPLC system (Agilent 1100; Agilent) equipped with a Zorbax Eclipse Plus C18 column (4.6 mm × 150 mm ...
-
bioRxiv - Physiology 2022Quote: Free fatty acid composition was evaluated by GC-MS (Agilent technology GC7890-MS5975). Briefly ...
-
bioRxiv - Plant Biology 2022Quote: ... whereas the amino acids were quantified using an HPLC system (Agilent 1100; Agilent) equipped with a Zorbax Eclipse Plus C18 column (4.6 mm × 150 mm ...
-
bioRxiv - Cell Biology 2020Quote: ... fatty acid oxidation was assessed by using the Seahorse XF24 Analyzer (Agilent Technologies) to measure mitochondrial respiration ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the fatty acids were dosed from the autosampler of a GC (Agilent 7890A) as pulses to the front inlet packed with the catalyst bed (maintained in the range 250-400 °C) ...
-
bioRxiv - Microbiology 2020Quote: ... Amino acid analysis was performed by HPLC (Agilent 1100; Agilent Technologies, Massy, France) with a guard cartridge and a reverse phase C18 column (Zorbax Eclipse-AAA 3.5 μm ...
-
bioRxiv - Molecular Biology 2021Quote: ... Library quality was confirmed using the Agilent 2200 TapeStation Nucleic Acids System (Agilent).
-
bioRxiv - Molecular Biology 2022Quote: ... and 2.5 µM medronic acid (5191-4506, Agilent Technologies, Santa Clara, CA, USA). The LC gradient was ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The quality of nucleic acids was assessed with a Fragment Analyzer (Agilent, Switzerland) at the Lausanne Genomic Technologies Facility of the University of Lausanne.
-
bioRxiv - Cancer Biology 2024Quote: ... 2× 104 EO771 and PyMT cells were cultured in 100 µL of DMEM supplemented with 10% FBS and 4 mM glutamine with or without S100A8 or S100A8/9 recombinant protein (5 or 10 µg/mL) and plated in XFe96/XF Pro PDL Cell Culture Microplates (Agilent Technologies, Cat. #103799-100, US). Following 16h overnight incubation ...
-
bioRxiv - Molecular Biology 2024Quote: ... The supernatants were fractionated on a reversed-phase Supelco Discovery BIO wide Pore C18-3 (4.6 × 150 mm, 3 µm particle size) column operated by a HPLC Agilent 1200 (Agilent Technologies, Waldbronn, Germany) chromatography system ...
-
bioRxiv - Biophysics 2023Quote: ... The cells were fixed with 3% formalin 3 days after the transfection and analyzed with the ACEA Quanteon (Agilent NovoExpresss Version 1.5.0), as described (22 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Anti-Ki-67 (Antigen Clone TEC-3) antibody (Dako), anti-Cleaved Caspase 3 (Asp175 ...
-
bioRxiv - Genomics 2020Quote: ... Ki67 (rat, DAKO M7249, clone TEC-3, 1:100), Carbonic Anhydrase 2 (rabbit ...
-
bioRxiv - Immunology 2023Quote: ... the peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... Agilent Bio SEC-3 Column (Agilent Technologies, CA, USA) or HiLoad 16/60 Superdex 200 pg SEC column (GE Healthcare ...
-
bioRxiv - Microbiology 2023Quote: ... using the Bio SEC-3 300A HPLC column (Agilent) and an isocratic elution with 100 mM ammonium acetate (pH 7.0 ...
-
bioRxiv - Cancer Biology 2024Quote: ... (3) CD8 (Cytotoxic T Cells, 1:400, M7103; Dako)–Opal 570 ...
-
bioRxiv - Microbiology 2021Quote: Organic acids and ethanol were measured by high-performance liquid chromatography (Agilent, 1260 Infinity), using a standard analytical system (Shimadzu ...
-
bioRxiv - Bioengineering 2020Quote: ... butyric acid and glucose were measured using a high-performance liquid chromatography (HPLC, Agilent Technologies 1260 Infinity series ...
-
bioRxiv - Genetics 2020Quote: ... and L191H amino acid changes (Integrated DNA Technologies) and QuickChange II SDM Kit (Agilent). The pcDNA3-Myc-Exosc5 (pAC3519 ...
-
bioRxiv - Genetics 2020Quote: ... and L206H amino acid changes (Integrated DNA Technologies) and QuickChange II SDM Kit (Agilent). All plasmids were sequenced to ensure the presence of desired mutations and absence of any other mutations.
-
bioRxiv - Biophysics 2022Quote: ... Nucleic acid purification was performed using a high-performance liquid chromatography (HPLC, Agilent 1100) equipped with a diode array detector ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Residual sugars and organic acids were measured using a HPLC 1100 (Agilent Technologies, USA) equipped with an Aminex 75H column with 4 mM sulfuric acid as the mobile phase at 0.6 mL/min and analyzed using a refractive index detector (RID).
-
bioRxiv - Physiology 2024Quote: ... Amino acid substitutions were introduced via site-directed mutagenesis with the QuikChange method (Stratagene). Channels were truncated by replacing the respective amino acid triplet by a stop codon and appropriate restriction site ...
-
bioRxiv - Bioengineering 2024Quote: ... Standards and a HPLC column (AdvanceBio Amino Acid Analysis column) were purchased from Agilent. The amino acids were derivatized with OPA for primary amino acids and FMOC for secondary amino acids as per the protocol provided by Agilent ...
-
bioRxiv - Bioengineering 2024Quote: Amino acid analysis was performed using a GC-MS/MS instrument (Agilent Technologies, USA) equipped with an autosampler ...
-
bioRxiv - Genomics 2022Quote: ... we established an automated 3’UTR-seq (QuantSeq 3’mRNA-seq; Lexogen GmbH, Vienna) using the Agilent NGS Workstation (Agilent Technologies, Santa Clara) at The Centre for Applied Genomics (TCAG ...
-
bioRxiv - Biophysics 2024Quote: ... Fluorescence measurements were carried out using 3×3 mm quartz cuvettes (Hellma Analytics, LineaLab, Badalona, Spain) in a Cary Eclipse spectrofluorimeter (Agilent Technologies, Madrid, Spain). Blanks in the absence of protein were routinely measured and subtracted ...
-
bioRxiv - Physiology 2020Quote: The fatty acid oxidation (FAO) was measured using a microfluorimetric Seahorse XF96 Analyzer (Agilent Technologies) according to the protocol supplied by the manufacturer with minor modifications ...
-
bioRxiv - Microbiology 2024Quote: Substitutions of S amino acids were introduced using Quikchange Lightning Site-Directed Mutagenesis kit (Agilent) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... AMP-derivatised fatty acids as [M+H]+ were aligned using Mass Profinder v10.0 (Agilent Technologies) with an RT tolerance of 0.5 min and MS1 tolerance of 10 ppm ...
-
bioRxiv - Genomics 2020Quote: ... A D1000 Screen Tape assay (Agilent, Cat.5067-5582/3) was used with the 2200 Tape Station (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and endogenous peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 x 2.0 mm Polaris 3 C8-A column (Agilent, Middelburg ...
-
bioRxiv - Microbiology 2024Quote: ... or 3) a HiPlex H column (4.6 x 250mm, Agilent). For 1) ...
-
bioRxiv - Microbiology 2024Quote: ... connected to a BioTek BioStack 3 microplate stacker (Agilent Technologies).
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were submitted to the Stanford Protein and Nucleic Acid Facility for quality assessment by Agilent Bioanalyzer to determine the RNA integrity (RIN ...
-
bioRxiv - Microbiology 2022Quote: ... Separation of bile acids was performed on a 1290 series HPLC from Agilent (Santa Clara, CA) using an Agilent SB-C18 2.1X100mm 1.8 µm column with a 2.1X5mm 1.8um guard column ...
-
bioRxiv - Cell Biology 2022Quote: ... Amino acid substitutions and deletions were introduced by site-directed mutagenesis using the QuikChange Kit (Agilent).
-
bioRxiv - Biophysics 2020Quote: ... Amino acids were then converted into respective fluorescent derivatives using o-phthalaldehyde (OPA) (Agilent #5061-3335). Briefly ...