Labshake search
Citations for Agilent :
201 - 250 of 776 citations for 3 Chloro phenyl 9H fluoren 9 ylmethoxycarbonylamino acetic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... RT-PCR was performed with 1μL of diluted cDNA (1:9) in a Brillant III ultra fast SYBRgreen QPCR master mix (Agilent Technologies, USA) using a StepOnePlus Real-Time PCR System (Applied biosystems ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 μm paraffin-embedded tissue sections were either dewaxed and subjected to antigen retrieval treatment with Tris-EDTA buffer pH 9 for 20 min at 97°C using a PT Link (Dako – Agilent) or dewaxed as part of the antigen retrieval process using the Low pH EnVision ™ FLEX Target Retrieval Solutions (K8005 ...
-
bioRxiv - Cell Biology 2020Quote: ... Prior to immunohistochemistry antigen retrieval was performed using Tris-EDTA buffer pH 9 for 20 min at 97°C using a PT Link (Dako – Agilent). Quenching of endogenous peroxidase was performed by a 10 min incubation with Peroxidase-Blocking Solution (Dako REAL S2023) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Heat-induced antigen retrieval (HIER) was performed in a coverslip jar containing 1x Dako pH 9 Antigen Retrieval Buffer (Agilent, S2375) while using a PT module filled with 1x PBS ...
-
bioRxiv - Neuroscience 2024Quote: ... 6.5-9) and concentration (5-50 ng/µl; 260/280 values >1.7) were evaluated using the Agilent 2100 Bioanalyzer (Agilent Technologies, CA) and Nanodrop (Thermo-fisher ...
-
bioRxiv - Immunology 2024Quote: ... Epitope retrieval was then performed at 95 °C for 10 min at pH 9 with Dako Target Retrieval Solution (Agilent, USA), in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... of RF energy with varying input power to the antenna (9-68 W, measured by a power meter (U2001A Power Sensor connected to N9912A Field Fox Spectrum analyzer, Agilent/Keysight) and a bidirectional coupler (778D ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 2uL aliquots from each plated sample were diluted 1:9 on a Bravo liquid handling platform (Agilent, Santa Clara, CA, USA). 5uL aliquots from each diluted sample were pipetted into 384-well plates for mNGS library preparation ...
-
bioRxiv - Biochemistry 2024Quote: ... 120-73-0) and 2.5 mmol/L hexakis(1H, 1H, 3H-tetrafluoropropoxy)phosphazine (HP-0921, CAS No. 58943-98-9) (Agilent, Cheadle, UK).
-
bioRxiv - Molecular Biology 2022Quote: 3*10^3 of HPLFs per well were seeded into Seahorse XFe96 well plate (Agilent Technologies, 200941) for overnight ...
-
bioRxiv - Cell Biology 2020Quote: ... for amino acids and an Eclipse Plus C18 (1.8 μm; Agilent) for TCA and PPP intermediates ...
-
bioRxiv - Microbiology 2021Quote: ... The fatty acid profiles were analyzed by gas chromatography (Agilent 7890A) using the RTSBA6 method/library ...
-
bioRxiv - Genetics 2021Quote: ... and organic acids by a dual-wavelength absorbance detector (Agilent G1314F).
-
bioRxiv - Physiology 2021Quote: Amino acid concentrations were determined with high-performance liquid chromatography (Agilent Technologies 1100 HPLC System ...
-
bioRxiv - Microbiology 2021Quote: ... and analysed as fatty acid methyl esters by gas chromatography (Agilent 6890N ...
-
bioRxiv - Neuroscience 2022Quote: ... Anti glial fibrillary acid protein (Abcam, GFAP, Dako Z0334 1:1000); Anti CD68 (Biorad MCA1957 ...
-
bioRxiv - Neuroscience 2022Quote: ... and glial fibrillary acid protein (GFAP; Z0334, Dako, RRID:AB_10013382, 1:500) were performed as previously described (Muñoz-Manchado et al ...
-
bioRxiv - Immunology 2024Quote: Extracellular acid ratio was determined by Seahorse Flux Analyzer XF96 (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... The long chain fatty acid oxidation stress test (Agilent, 103672-100) was performed to measure oxygen consumption rates (OCR ...
-
bioRxiv - Plant Biology 2023Quote: ... Lipid bands were scratched from the plates and their fatty acids extracted (fatty acid methyl esters FAMEs) and quantified by GC-MS (Agilent 7890 A and MSD 5975 Agilent EI) as in (39) ...
-
bioRxiv - Bioengineering 2021Quote: ... mRNA was isolated from high quality total RNA samples with RIN > 9 and 28S:18S > 1 (measured with an Agilent 2100 Bioanalyzer) using poly-T oligonucleotide beads ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... a 2uL aliquot from each plated sample was diluted 1:9 on a Bravo liquid handling platform (Agilent, Santa Clara, CA, USA). A 5 μL aliquot from each diluted sample was arrayed into a 384 well plate for input into the mNGS library prep ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Fixated lung tissue sections underwent antigen retrieval (pH 9 buffer) using a Dako PT Link pre-treatment module (Agilent, Santa Clara, CA). Samples were washed with PBS and blocked with Dako protein block (Agilent ...
-
bioRxiv - Pathology 2020Quote: ... Deparaffinization and antigen retrieval were performed in Target Retrieval Solution with pH 9 (ACE2) or pH 6 (Ki-67) at 97°C for 20 min using the PT Link platform (Dako, Glostrup, Denmark). Subsequently ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA quality and concentration were assessed using the 2100 Bioanalyzer on an RNA 6000 Nano Assay (Agilent Technologies, Inc, all RINs > 9). Libraries were constructed by amplifying 500 ng of total RNA using 9 PCR cycles with the KAPA mRNA HyperPrep Kit (KAPA Biosystems) ...
-
bioRxiv - Cancer Biology 2023Quote: ... depending on the antibody used (HIF-1α, Dako Target Retrieval Solution pH 6; for BACH-1, Dako Target Retrieval Solution pH 9). Next ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells used for all experiments were ≤9 passages from stock and tested negative for mycoplasma contamination (Agilent MycoSensor QPCR Assay Kit, 302107).
-
bioRxiv - Pathology 2024Quote: ... and antigen retrieval was carried out using a sodium citrate buffer (10 mM, pH 6 or 9) on a PT Link system (DAKO, CA, USA). Endogenous peroxidase blockade was done using 3% hydrogen peroxide (Millipore ...
-
bioRxiv - Cell Biology 2024Quote: ... Step 3 was endogenous peroxidase blocking (Dako REAL Peroxidase-blocking reagent ...
-
Machine learning and data-driven inverse modeling of metabolomics unveil key process of active agingbioRxiv - Systems Biology 2024Quote: ... Gas separation was performed on the HP-5MS column (30 m 3 0.25 mm 3 0.25 mm, Agilent Technologies).
-
bioRxiv - Plant Biology 2020Quote: The contents of celastrol and wilforic acid A were analyzed by Agilent 1260LC-6400 QQQ (triple quadrupole mass) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... using a telomere PNA (peptide nucleic acid) FISH Kit/FITC (DAKO, Denmark) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... The Long-Chain Fatty Acid Substrate Oxidation kit (Agilent cat #103672-100) was utilized to probe differences in OCR upon injection with either vehicle (media only ...
-
bioRxiv - Microbiology 2023Quote: ... Amino acid analysis was performed by high-pressure liquid chromatography (HPLC) (Agilent 1100 ...
-
bioRxiv - Microbiology 2023Quote: ... Resin acid identification and quantification were performed by capillary GC (Agilent 7890A). Helium ...
-
bioRxiv - Cancer Biology 2022Quote: ... The matrix employed was α-cyanohydroxycinnamic acid obtained in solution from Agilent Technologies ...
-
bioRxiv - Biophysics 2022Quote: ... Amino acid analysis was performed on an Agilent 1260 HPLC (Agilent Technologies) equipped with a fluorescence detector using automated o-phtalaldehyde/2-mercaptopropionic acid (OPA/MPA ...
-
bioRxiv - Microbiology 2024Quote: ... Fatty acids were identified with a mass spectrometer (Agilent 5977B GC/MSD) according to the comparison of retention times of commercial fatty acid standards (Supelco 37) ...
-
bioRxiv - Genomics 2020Quote: ... a plasmid encoding the replicases of AAV serotype 2 and the capsid of AAV serotype 9) and pHelper (Agilent Technologies, lab reference pZMB0088) which provides AAV adenoviral helper functions ...
-
bioRxiv - Physiology 2020Quote: ... Acetone was measured using an agilent DB-35MS column (30 m 3 0.25mm i.d. 3 0.25 mm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Developmental Biology 2024Quote: ... By site-directed mutagenesis the V5 tag of the pMT-Bip V5-His A vector was replaced by a Myc sequence (EQKLISEEDL) using the primers: Fw: 5’– AGCGAAGAGGATCTGACGCGTACCGGTCATCAT–3 and 5’– AATCAGTTTCTGTTCGAATTCCACCACACTGGACTAGTAGGTACC–3’ and the PFU ultra (Agilent). The cDNA for Drospondin without the signal peptide sequence and the stop codon was amplified using the clone GH02025 from Drosophila Genome Resource Center (DGRC) ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fragment 3 was pBluescript KS (-) (Stratagene, California USA), which was digested using Xba ...
-
bioRxiv - Pathology 2021Quote: ... 3′-diaminobenzidine tetra-hydrochloride chromogen (DAB, K3468, Dako) was added to all sections and the reaction was stopped with distilled water ...
-
bioRxiv - Microbiology 2023Quote: ... then labeled using Cyanin-3 CTP (Agilent Technologies) and hybridized on chips containing 45000 probes (4×44K Whole Human Genome) ...
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm 2.7 μm HPLC column (Agilent) with a Poroshell 120 PFP ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...