Labshake search
Citations for Agilent :
2801 - 2850 of 6226 citations for Cow Protein L Isoaspartate PCMT1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... Total RNA was analyzed for quantity and quality using the RNA 6000 Pico Kit (Agilent). Sequencing ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR-based mutagenesis kit exactly as described by the manufacturer (Stratagene, La Jolla, CA, USA). Mutagenized clones were isolated and subjected to Sanger DNA sequencing to verify the entire coding sequence for the presence of the desired mutation and the absence of any PCR-induced sequence errors.
-
bioRxiv - Immunology 2021Quote: ... After validation of the RNA quality with Bioanalyzer 2100 (using Agilent RNA6000 nano chip kit), 75 ng of total RNA was reverse transcribed using the GeneChip® WT Plus Reagent Kit (Affymetrix ...
-
bioRxiv - Immunology 2021Quote: ... cloned into pCDNA3.1 was mutated using the QuikChange Lightning Site-Directed Mutagenesis kit (Agilent Technologies) to include D614G (original ...
-
bioRxiv - Molecular Biology 2020Quote: Point mutations were generated using QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent Technologies, #210513) if not otherwise stated ...
-
bioRxiv - Genetics 2021Quote: DNA libraries of the purified fragments were constructed with SureSelect Library Prep Kit (Agilent, USA). In brief ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was prepped by reverse-transcriptase PCR using the AffinityScript cDNA QPCR Synthesis kit (Agilent Technologies ...
-
bioRxiv - Immunology 2021Quote: ... Sections were incubated with primary antibodies for CD117 (A4502-CD117,c-kit, DAKO, 1:500), followed by washing and incubation with post primary (Novolink ...
-
bioRxiv - Genomics 2021Quote: ... using a DNF-474 High Sensitivity NGS Fragment Kit 1-6000bp (Agilent, DNF-474-0500). We generally observe approximately 5-10 ng/ul ...
-
bioRxiv - Genomics 2020Quote: ... Library quality and yield was measured using Bioanalyzer High Sensitivity DNA kit (5067-4626, Agilent) and Qubit dsDNA High Sensitivity Assay Kit (Q32854 ...
-
bioRxiv - Genetics 2020Quote: ... DNMT1 point mutation was generated by a QuikChange II XL Site-Directed Mutagenesis Kit (Agilent), with the residue numerations based on the isoform 1 of DNMT1 that contains 1616 amino acids ...
-
Mask, the Drosophila Ankyrin Repeat and KH domain-containing protein, regulates microtubule dynamicsbioRxiv - Neuroscience 2021Quote: ... We used the QuickChange II XL site-mutagenesis kit (from Agilent Technology, Santa Clara, CA) to substitute wild type sequence with the mutant sequence ...
-
bioRxiv - Genetics 2020Quote: ... cDNA library size was checked using Fragment Analyzer HS NGS Fragment Kit (1-6000bp) (Agilent formerly Advanced Analytical ...
-
bioRxiv - Microbiology 2021Quote: ... samples were analyzed on an Agilent BioAnalyzer using the Eukaryotic Total RNA Nano Kit (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... Total RNA quality was measured using Agilent RNA 6000 Pico kit (#5067-1513) by Agilent Bioanalyzer 2100 (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... Library quality was determined used the Agilent DNA 1000 Kit on a 2100 BioAnalyzer (Agilent). Validated libraries were subjected to 75-bp single-end sequencing on the Illumina NextSeq 500 platform.
-
bioRxiv - Cancer Biology 2022Quote: Oxidative respiration was measured using XF Cell Mito Stress Test Kit (Agilent Technologies, 103015-100). 1 x 104 cells per well were seeded on an XF96 Cell Culture Microplate ...
-
bioRxiv - Cancer Biology 2022Quote: ... EZH2’s SET domain deletion was generated by a site-directed mutagenesis kit (Agilent, 200521). All plasmids were verified by Sanger sequencing ...
-
bioRxiv - Biochemistry 2022Quote: ... Site-directed mutations were introduced using the M27-QC primers and the QuikChangeII kit (Agilent) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Site directed mutagenesis was performed with the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent; 210513). Plasmids were integrated via dual transfection with pCAG-SpCas9-GFP-U6-gRNA (Addgene ...
-
bioRxiv - Biochemistry 2022Quote: ... The total RNA quality was checked with Bioanalyzer (Agilent, RNA 6000 Nano kit, 5067-1511). Small RNA library preparation started with 1ug high quality total RNA ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA integrity was assessed using RNA 6000 Pico Kit for Bioanalyzer (Agilent Technologies 5067-1513) and RNA-seq libraries were constructed using NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB E7770 ...
-
bioRxiv - Cancer Biology 2022Quote: Oxidative respiration was measured using XF Cell Mito Stress Test Kit (Agilent Technologies, 103015-100). 1 × 104 cells per well were seeded on an XF96 Cell Culture Microplate ...
-
bioRxiv - Bioengineering 2022Quote: ... Alanine mutants of LRP6 ectodomain were generated using QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: Point mutations were created using the QuickChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies) with either the pBRA SP-Tlde1WT plasmid or Tlde1WT pET28b plasmid used as template ...
-
bioRxiv - Cell Biology 2022Quote: ... The R73K mutation was introduced using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies). The primer for mutagenesis (AATGCGAGCTATCTTTAATCAAGAAAGTTCCTTCTGGTGCC ...
-
bioRxiv - Cancer Biology 2022Quote: ... DNA fragments were tested on a 2100 Bioanalyzer using the High Sensitivity DNA Kit (Agilent Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA integrity was checked on the Agilent TapeStation using the RNA Screen Tape kit (Agilent). Total RNA (500 ng ...
-
bioRxiv - Immunology 2022Quote: The Seahorse XF Cell Mito Stress Test Kit (Agilent, Santa Clara, CA; Catalog #103015-100) was run on a Seahorse XFe96 Bioanalyzer (Agilent ...
-
bioRxiv - Genomics 2022Quote: ... samples were run with the Agilent High Sensitivity DNA Kit (Agilent Technologies, Santa Clara, CA) on the Agilent 2100 Bioanalyzer system (Agilent Technologies ...
-
bioRxiv - Immunology 2022Quote: ... cloned into pCDNA3.1 was mutated using the QuikChange Lightning Site-Directed Mutagenesis kit (Agilent Technologies) to include D614G (ancestral D164G ...
-
bioRxiv - Immunology 2022Quote: ... cloned into pCDNA3.1 was mutated using the QuikChange Lightning Site-Directed Mutagenesis kit (Agilent Technologies) and NEBuilder HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Genomics 2022Quote: ... Quality of the fragmented RNA was evaluated by the Bioanalyzer pico kit (Agilent Technologies, USA). ~20ng/μl of mechanical extracted RNA were added on a 16S surface probe coated QC array in an in situ cDNA reaction ...
-
bioRxiv - Genetics 2022Quote: ... The primers used for mutagenesis using the Quickchange Lightning mutagenesis kit (Stratagene, La Jolla, CA) are as follows:
-
bioRxiv - Immunology 2022Quote: ... The quality of extracted RNA was assessed using Bioanalyzer and RNA 6000 Nano Kit (Agilent). Gene expression levels were obtained using Human Clariom S arrays on GeneTitan MC Instrument International (Thermo Fisher Scientific).
-
bioRxiv - Molecular Biology 2022Quote: ... Silent mutations on TLN1 were generated with the QuikChange site-directed mutagenesis kit (Agilent Technologies) to make our construct resistant against the previously described siRNA specific for TLN1 (Cat ...
-
bioRxiv - Molecular Biology 2022Quote: ... and RNA quality was further assessed using RNA 6000 Pico Kit and Bioanalyzer 2100 (Agilent).
-
bioRxiv - Microbiology 2022Quote: ... and V3306F were introduced using the Quick-change II Site-Directed Mutagenesis Kit (Agilent, UK).
-
bioRxiv - Molecular Biology 2022Quote: ... The libraries were amplified with 7 PCR cycles using Herculase II Fusion Polymerase kit (Agilent). Libraries hybridisation was performed as described previously 68 using probes mapping to 122 polycomb target genes promoters and 78 control active gene promoters ...
-
bioRxiv - Neuroscience 2023Quote: ... and quality was checked using a 2100 Bioanalyzer with High Sensitivity DNA kit (Agilent Technologies). Libraries were pooled and sequenced with a NovaSeq 6000 platform (S1 Cartridge ...
-
bioRxiv - Physiology 2023Quote: ... libraries were verified using a Fragment Analyzer and the High Sensitivity NGS kit (Agilent, USA), and quantified using the KAPA Library quantification kit (Roche ...
-
bioRxiv - Physiology 2023Quote: miRNAs were quantified using a Fragment Analyzer and the Small RNA Analysis kit (Agilent, USA). Libraries were constructed using a NEXTFLEX Small RNA-seq v3 kit (Perkin Elmer ...
-
bioRxiv - Immunology 2022Quote: ... RNA integrity was accessed using the RNA 6000 Pico Kit (Agilent Technologies, Santa Clara, CA). The cDNA libraries were prepared using NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina 96 reactions (New England Biolabs) ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA integrity was checked with the Bionalyzer (agilent 2100 Bioanalyzer, Agilent RNA 6000 nano kit). Five ng of mRNA from each sample were used for retro-transcription ...
-
bioRxiv - Cancer Biology 2024Quote: ... TSSK6 kinase mutations were made using the QuikChange XL Site-Directed Mutagenesis Kit (200516, Agilent). pLX302-TSSK6-V5 was used as a template ...
-
bioRxiv - Neuroscience 2022Quote: Reverse transcription of RNA was performed using the AffinityScript QPCR cDNA Synthesis Kit (Agilent Technologies). Total RNA e (250ng ...
-
bioRxiv - Physiology 2022Quote: ... and the integrity was controlled by gel electrophoresis using a RNA 6000 Nano Kit (Agilent) according to the manufacturer’s protocol using a 2100 Bioanalyzer (Agilent) ...
-
bioRxiv - Molecular Biology 2022Quote: ... using the QuickChange II XL Site Directed Mutagenesis kit (Agilent Technologies, Santa Clara, CA, USA) and the following primers ...
-
bioRxiv - Neuroscience 2022Quote: ... Error-prone PCR was done using Mutazyme PCR from Genemorph II mutagenesis kit (Agilent Technologies) according to the manufacturer’s suggestions ...
-
bioRxiv - Microbiology 2022Quote: ... and an Agilent Femto Pulse system with an Ultra Sensitivity NGS kit (Agilent, FP-1101), respectively ...