Labshake search
Citations for Agilent :
2601 - 2650 of 6226 citations for Cow Protein L Isoaspartate PCMT1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... and 2 µM Antimycin A + Rotenone (Seahorse XF Cell Mito Stress Test Kit, Agilent) were added sequentially to the Agilent Seahorse XFe96 Extracellular Flux Analyzer via injection ports to determine basal and maximum respiration ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA libraries were quantified using the Agilent High Sensitivity DNA Kit (Agilent, 5067-4626) and were sequenced on an Illumina NovaSeq ...
-
bioRxiv - Immunology 2024Quote: ... with dsDNA HS (High Sensitivity) Assay Kit and size distribution was determined by Agilent High Sensitivity DNA Kit ...
-
bioRxiv - Microbiology 2024Quote: ... mutations were made by using the QuikChange II XL site-directed mutagenesis kit (Agilent) on the JN.1 construct that we previously generated1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the mixture labelled with LowInput QuickAmp Labeling Kit One-Color (Agilent 5190-2305). For each sample ...
-
bioRxiv - Synthetic Biology 2024Quote: ... A80T and S79G/A80T were obtained with the QuickChange site-directed mutagenesis kit (Stratagene), using as template for the mutagenic reactions the plasmid pJLPM ...
-
bioRxiv - Microbiology 2020Quote: ... For intact protein analysis,10 μL of desalted protein (∼1 mg/ml) was injected onto a Zorbax 300Å Stable Bond C8 column (Agilent Technologies, 4.6 x 50 mm, 3.5 μM) for reversed phase separation at 60°C and 0.4 mL/min ...
-
bioRxiv - Genomics 2021Quote: ... The cDNA library quality was evaluated using the 2100 Bioanalyzer (DNA high sensitivity kit, Agilent, cat ...
-
bioRxiv - Cancer Biology 2021Quote: ... The other plasmids were obtained by PCR using the QuickChange Site-Directed Mutagenesis Kit (Stratagene) using specific oligonucleotides as follows ...
-
bioRxiv - Molecular Biology 2019Quote: RNA integrity was assessed using RNA 6000 Pico Kit for Bioanalyzer (Agilent Technologies #5067-1513) and mRNA was isolated using NEBNext Poly(A ...
-
bioRxiv - Cell Biology 2020Quote: ... ATP synthesis was measured with the Seahorse XF Real-Time ATP Rate Assay kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... Quality of RNA was assessed on a Bioanalyzer using the RNA 6000 Pico Kit (Agilent). Acceptable samples were determined by eye ...
-
bioRxiv - Genetics 2021Quote: ... SCN5A individual zones on small plasmids were mutagenized using the QuikChange Lightning Multi kit (Agilent) with primers designed using the online QuikChange Primer Design tool ...
-
bioRxiv - Molecular Biology 2020Quote: ... The pBS BspQI site was removed by site-directed mutagenesis using a QuikChange kit (Agilent). New BspQI sites were added to the plasmids either 245 bp (to visualize the nascent leading strand ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA integrity numbers (RIN) were calculated using the RNA 6000 Pico Kit 2100 Bioanalyzer (Agilent). All RNA was high-quality with RIN values of 7.2 or greater ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... cDNA was synthesized using the AffinityScript qPCR cDNA Synthesis Kit (Agilent Technologies, Santa Clara, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... product size distribution and quantity were assessed on a Bioanalyzer High Sensitivity DNA Kit (Agilent). The amplified cDNA (200 ng ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and evaluated quality with a 2100 Bioanalyzer and DNA 1000 Kits (Agilent, Santa Clara, California). We then pooled libraries that passed quality inspection and sequenced this pool with 150-bp paired-end reads on an Illumina HiSeq4000 at the University of Illinois at Urbana-Champaign Roy J ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... labelled with [α-32P]-dCTP through the Prime-it II random primer labelling kit (Stratagene) was used ...
-
bioRxiv - Cell Biology 2022Quote: ... A39E and was generated using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent Technologies). SURF4 for mammalian expression in the pcDNA3.1 vector containing a N-terminal FLAG tag was generated by GeneScript ...
-
bioRxiv - Immunology 2022Quote: Mutagenesis reactions were performed using the QuickChange Lightning Site-Directed Mutagenesis Kit (Agilent Cat # 210519) using as template a S protein mammalian expression vector based on the Wuhan sequence (Genbank MN908947.3 ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA integrity was determined using the Bioanalyzer RNA 6000 Nano assay kit (Agilent, 5067-1511). RNA library construction was performed with the TruSeq RNA Library Prep Kit v2 (Illumina ...
-
bioRxiv - Molecular Biology 2020Quote: ... was used to determine RNA integrity using High Sensitivity RNA Screentape analysis kit (Agilent, USA).
-
bioRxiv - Molecular Biology 2020Quote: ... Library fragment size was determined using a BioAnalyzer (RNA 6000 Nano Kit; Agilent, CA, USA) and concentration was quantified on a Qubit (Qubit High Sensitivity RNA Kit ...
-
bioRxiv - Molecular Biology 2021Quote: ... The resulting size-selected libraries were analyzed with the Agilent High Sensitivity DNA Kit (Agilent) and sequenced with the NovaSeq 6000 S1 SE 75 (HEK293T samples ...
-
bioRxiv - Molecular Biology 2021Quote: ... quality was assessed on a Bioanalyzer 2100 with the RNA 6000 Pico Assay kit (Agilent). cDNAs were constructed using the SMARTer v4 Ultra low Input RNA kit (Takara) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and for integrity using the RNA 6000 Nano Kit on the 2100 Bioanalyzer (Agilent Technologies). RNA was treated using the TURBO DNA-free™ Kit (Invitrogen ...
-
bioRxiv - Genomics 2020Quote: ... quality of libraries was assessed using a high sensitivity DNA kit on a Bioanalyzer (Agilent) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... and size distribution was assessed with a 2100 Bioanalyzer High Sensitivity DNA Analysis Kit (Agilent). Multiplexed bulk human placental libraries were sequenced on the NextSeq500 platform using 150 cycle single-end protocol generating a total of 36.9 to 70.9 million 101bp reads per sample ...
-
bioRxiv - Genomics 2020Quote: ... The material was then assessed with a Bioanalyzer RNA 6000 Pico kit (Agilent Technologies, USA). 8μl of the eluted 12μl aRNA was transferred into a new 96-well PCR plate (Eppendorf ...
-
bioRxiv - Genomics 2020Quote: ... The libraries were quality controlled on Fragment Analyzer [using DNA7500 kit (5067-1506, Agilent Technologies). The library yields were determined based on 200-800-bp range.
-
bioRxiv - Immunology 2021Quote: Deletions or point mutations were introduced using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent) or In-Fusion HD Cloning Kit.
-
bioRxiv - Immunology 2021Quote: ... RNA quality was evaluated with Bioanalyzer RNA pico kit (Agilent Technologies Inc, Santa Clara, CA). Poly(A)-selected RNA was amplified using the SMARTseq2 protocol (Clontech – Picelli et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... The libraries were amplified with 7 PCR cycles using Herculase II Fusion Polymerase kit (Agilent). Libraries were next hybridized in the following way ...
-
bioRxiv - Molecular Biology 2021Quote: RNA quailty was studied with BioAnalyzer RNA analysis (5067-1511, Agilent, RNA 6000 nano kit). Small RNA libraries were produced with NEBNext Multiplex SmallRNA Library Prep Kit for Illumina (E7560S ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Concentration of each library was determined using either the qPCR Quantification Kit for Illumina (Agilent) or the KAPA Library Quantification Kit for Illumina (KAPA Biosystems) ...
-
bioRxiv - Cancer Biology 2019Quote: ... and the fragment size was checked using the Bioanalyzer High Sensitivity DNA Kit (Agilent Technologies). Libraries were pooled equimolarily and sequenced on the Illumina NextSeq platform ...
-
bioRxiv - Cancer Biology 2019Quote: ... Samples quality assessment/size was validated by Bioanalyzer DNA-High sensitivity kit (Agilent # 5067-4626).
-
bioRxiv - Microbiology 2019Quote: ... and libraries were prepared using the SureSelect Automated Library Prep Kit (Agilent, Santa Clara, USA). Index tagged samples were amplified using KAPA HiFi DNA polymerase ...
-
bioRxiv - Cancer Biology 2019Quote: ... AGO2Y393F mutant construct was generated using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) from the FH-AGO2 plasmid described above using the primers hAGO2_Y393F_Fwd 5’AAATTCACGGACGAATGGATCTGTGTTGAAACTTGCAC3’ and hAGO2_Y393F_Rev 5’GTGCAAGTTTCAACACAGATCCATTCGTCCGTGAATTT3’ ...
-
bioRxiv - Plant Biology 2019Quote: ... The probes were prepared using Prime-It® Rm T Random Primer Labeling kit (Stratagene). The probe for AtMIOX4:pBIB-Kan was amplified with npt-II forward (5’-AGA GGC TAT TCG GCT ATG AC-3’ ...
-
bioRxiv - Neuroscience 2019Quote: ... and RNA quality was assessed using the Bioanalyser (Agilent RNA 6000 Pico kit; #5067-1513). The libraries were prepared using 0.5-2 ng of non-cerebellum microglia RNA samples with RIN value ≥ 7 and cerebellar microglia with RIN value ≥ 6 ...
-
bioRxiv - Genomics 2019Quote: ... and library qualification and quantification reagent using Bioanalyzer High Sensitivity Kit was purchased from Agilent. NextSeq 500/550 kit for short read sequencing was purchased from Illumina.
-
bioRxiv - Biochemistry 2019Quote: Site-specific mutagenesis was performed using the QuikChange™ Site-Directed Mutagenesis Kit from Stratagene. All mutants were confirmed by sequencing of plasmid DNA at Eurofins MWG Operon (Ebersberg ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... The cDNA libraries were prepared using SureSelect Strand Specific RNA Library Preparation Kit (Agilent Technologies) and RNA and cDNA qualities were assessed using BioAnalyzer Kits (Agilent Technologies ...
-
bioRxiv - Plant Biology 2020Quote: ... Site mutagenesis of RBOHC and RBOHD was performed with a QuickChange Kit (Agilent Technologies; 210518). The indicated proteins were incubated in protein kinase assay buffer (20 mM Tris-HCl [pH 7.6] ...
-
bioRxiv - Microbiology 2021Quote: ... and an Advanced Analytical Fragment Analyzer System using a Fragment Analyzer NGS Fragment Kit (Agilent), respectively ...
-
bioRxiv - Cell Biology 2021Quote: ... Modifications of these plasmids were made using the QuikChange Lightning site-directed mutagenesis kit (Agilent). The C-termini were tagged with mGFP or mCherry to facilitate protein localization ...
-
bioRxiv - Cell Biology 2020Quote: ... and R784A were introduced into pHalo-NM2C using QuikChange site-directed mutagenesis kit (200524; Agilent).
-
bioRxiv - Genomics 2021Quote: ... WGS libraries were quality controlled with the high-sensitivity DNA kit on the Bioanalyzer (Agilent), selecting for size distributions of 300bp to 1kb and concentrations over 1 nM ...