Labshake search
Citations for Agilent :
2751 - 2800 of 5601 citations for Rat CD178 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: Site-directed mutagenesis to generate the mutant RAS clones was performed with a QuikChange mutagenesis kit (Stratagene) and the primers for amino acid 180 site mutation of KRAS4A are CAGCAAAGAAGAAAAGACTCCTGGCAGTGTGAAAATT and AATTTTCACACTGCCAGGAGTCTTTTCTTCTTTGCTG.
-
bioRxiv - Molecular Biology 2019Quote: ... Point mutants in the yeast Ddi1 sequence were generated using the QuikChange Site-Directed Mutagenesis Kit (Agilent). Entry clones bearing domain deletions ...
-
bioRxiv - Genetics 2019Quote: ... Total RNA was isolated using the Absolutely RNA Mini Prep Kit (Agilent Technologies Inc., Santa Clara, CA), and was reverse transcribed using the iScript cDNA Synthesis Kit (Bio-Rad Laboratories) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Libraries were quantified by qPCR with the quality checked using a Bioanalyzer DNA 7500 Kit (Agilent Technologies). Pooled libraries were sequenced on the Illumina NextSeq or MiSeq platform using a 2 x75bp paired-end mode ...
-
bioRxiv - Cancer Biology 2019Quote: 3D-FISH was performed using the Dako FISH Histology accessory kit from Agilent (Catlog no: K579911-5) as per manufacturer guidelines ...
-
bioRxiv - Genetics 2020Quote: ... The quality of the library was checked using an Agilent 2100 Bioanalyzer (Agilent High Sensitivity DNA kit). Sequencing was performed by HiSeq 2500 (Illumina ...
-
bioRxiv - Systems Biology 2019Quote: ... was labeled with Cy3 during transformation into cDNA using an RNA Agilent miRNA Labeling Kit (Agilent, UK) and Spike Kit (Agilent ...
-
bioRxiv - Systems Biology 2019Quote: ... and quality of the RNA is established using the Bioanalyzer RNA Nano kit (Agilent Technologies, 5067-1511), it is recommended that RNA with an RNA Integrity Number (RIN ...
-
bioRxiv - Neuroscience 2019Quote: ... pPBase-BRAFwt was generated with quick change II XL single nucleotide site directed mutagenesis kit from Agilent according to the manufacturer protocol ...
-
bioRxiv - Bioengineering 2019Quote: Site-directed mutagenesis was carried out with the QuikChange XL Site-Directed Mutagenesis Kit (Agilent Technologies, US), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... and an RNA 6000 Nano Kit with the Bioanalyzer 2100 system (Agilent Technologies, Santa Clara, CA, USA). The TruSeq RNA Library Preparation Kit (Illumina ...
-
bioRxiv - Immunology 2020Quote: ... and was probed using dCTP-32P labeled probes made using the PrimeIT II kit (Agilent, cat. 300385) and Roche Quick Spin Columns (TE ...
-
bioRxiv - Cell Biology 2019Quote: ... Point mutants were made by site-directed mutagenesis using a QuikChange Site-Directed Mutagenesis kit (Stratagene, CA) (Yoshida et al. ...
-
bioRxiv - Microbiology 2019Quote: ... the experiments were done with two independent hybridizations for miRNA (Agilent’s miRNA Complete Labeling and Hyb Kit) or for mRNA (Cy3 and Cy5 interchanging labeling) ...
-
bioRxiv - Neuroscience 2019Quote: ... Single cysteine mutants (M173C, S235C, V304C and I367C) were generated using a QuickChange mutagenesis kit (Agilent Technologies).
-
bioRxiv - Microbiology 2019Quote: ... and the final concentration of each batch was determined with the qPCR NGS library quantification kit (Agilent). The five independent batches were sequenced in five independent runs with MiSeq reagent kit v3 (300bp PE).
-
bioRxiv - Microbiology 2019Quote: ... and the final concentration of the library was determined with the qPCR NGS library quantification kit (Agilent). Libraries were sequenced in four independent runs with MiSeq reagent kit v3 (600 cycles).
-
bioRxiv - Pathology 2019Quote: ... Sections were stained using the CSA II kit (Biotin-free catalysed signal amplification system; DAKO, Glostrup, Denmark) and 3,3’-diaminobenzidine (DAB) ...
-
Dual functionality of the TasA amyloid protein in Bacillus physiology and fitness on the phylloplanebioRxiv - Microbiology 2019Quote: ... JC81 and JC149 were constructed via site-directed mutagenesis (QuickChange Lightning Site Directed Mutagenesis Kit – Agilent Technologies). Briefly ...
-
bioRxiv - Cancer Biology 2019Quote: ... followed by an anti-rabbit IgG antibody (MP-7401 ImmPress Reagent Kit) and DAB+ chromogen (Agilent Technologies). Slides were counterstained with hematoxylin Gill’s Formula (H-3401 ...
-
bioRxiv - Cell Biology 2019Quote: ... H3 S10A and H3 S10E using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent technologies, cat#200521) according to manufacturer’s instruction ...
-
bioRxiv - Genomics 2019Quote: ... RNA integrity was assessed on the Agilent Bioanalyzer using the RNA 6000 Nano Chip kit (Agilent Technologies). An RNA integrity number (RIN ...
-
bioRxiv - Cancer Biology 2020Quote: ... and RNA integrity number (RIN) was determined with the Agilent 2100 BioAnalyzer (RNA 6000 Nano Kit, Agilent). For library preparation ...
-
bioRxiv - Developmental Biology 2020Quote: ... The quality of each library was examined using a Bioanalyzer with High Sensitivity DNA Kit (Agilent Technologies) and a KAPA Library Quantification Kit for Illumina (Roche diagnostics ...
-
bioRxiv - Genomics 2019Quote: ... 300 ng of Cy3 and Cy5 labeled cRNA was fragmented using the gene expression hybridization kit (Agilent) in a total volume of 25 μl including 5 μl of 10x blocking agent and 1 μl of 25x fragmentation buffer ...
-
bioRxiv - Developmental Biology 2020Quote: ... Labeled DNA was then co-hybridized using the Oligo aCGHZChIP-on-chip Hybridization kit (Agilent Technologies, CA) and the difference in the HpaIIZMspI signal ratio was determined as the methylation value ...
-
bioRxiv - Microbiology 2019Quote: Quality of the DNase treated RNA was tested using RNA 6000 Nano Kit (Agilent, Santa Clara, USA) on a 2100 Bioanalyzer System (Agilent ...
-
bioRxiv - Bioengineering 2019Quote: ... The RNA quality was assessed using an RNA 6000 Pico Kit for Bioanalyzer (Agilent Technologies #5067-1513) and a NanoDrop 1000 UV-vis spectrophotometer (NanoDrop Technologies/Thermo Scientific ...
-
bioRxiv - Physiology 2021Quote: ... including Trizol treatment and RNA quality assessed by an Agilent 2100 Bioanalyzer (Agilent RNA 6000 Pico Kit). RNA was amplified using the WT PLUS Reagent Kit (Thermo Fisher Scientific Inc. ...
-
bioRxiv - Cancer Biology 2019Quote: ... A point mutation was made in RRSP using QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent Technologies) to change His4030 CAT codon to Ala (GCT ...
-
bioRxiv - Cell Biology 2021Quote: ... site directed mutagenesis was carried out by using Quik Change II Site-Directed Mutagenesis Kit (Agilent, USA). The primers used were ...
-
bioRxiv - Genomics 2021Quote: ... Sheering quality and chromatin quantity was determined using Agilent Bioanalyzer DNA 1000 kit (Agilent Technologies, CA, USA). Briefly ...
-
bioRxiv - Synthetic Biology 2021Quote: ... the homology arms containing plasmid was mutated using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, #200522) to delete the single-guide RNA (sgRNA ...
-
bioRxiv - Cell Biology 2020Quote: ... dsRNAs around 500bp in length were generated with the RNAMaxx™ High Yield Transcription Kit (Agilent, US). Cells were diluted to a concentration of 106 cells/ml in serum-free medium ...
-
bioRxiv - Microbiology 2021Quote: Mutations were made in the chuA or sRNA sequences by using the Quikchange XL mutagenesis kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... and G73A Sco-CHH-L) was performed using the QuikChange PCR-mediated Site-Directed Mutagenesis Kit (Agilent) according to the manufacturer's instruction with the plasmid pET-22b(+)-Sco-CHH-L encoding the wild-type Sco-CHH-L (24 ...
-
bioRxiv - Biochemistry 2020Quote: ... Single site mutagenesis was performed in the pET-15b using the QuikChange Site-Directed Mutagenesis Kit (Stratagene), as per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and by using High Sensitivity NGS Fragment Analysis Kit (DNF-474) on a Fragment Analyzer™ (Agilent). Libraries were then purified using Agencourt® AMPure® XP (Beckman Coulter ...
-
bioRxiv - Biochemistry 2021Quote: ... Site Directed Mutagenesis was carried out using the QuikChange Lightning II cloning kit (Agilent, Santa Clara, CA). PCR cloning was carried out using the NEB PCR cloning kit ...
-
bioRxiv - Biochemistry 2021Quote: ... RNA quality was assessed using the Fragment Analyzer DNF-471 standard sensitivity RNA analysis kit (Agilent Technologies). RNAseq libraries (500 ng ...
-
bioRxiv - Biochemistry 2020Quote: ... Q63R and L75G MA mutant constructs were generated using a QuickChange XL site-directed mutagenesis kit (Stratagene). Forward and reverse primers (Integrated DNA Technologies ...
-
bioRxiv - Neuroscience 2021Quote: ... and quality control of the final library using a Bioanalyzer High Sensitivity kit (Agilent, Santa Clara, CA) and Qubit dsDNA High-sensitivity Assay Kit (Molecular Probes ...
-
bioRxiv - Neuroscience 2021Quote: ... RNA concentrations and RIN values were obtained using the RNA ScreenTape kit and the Tapestation system (Agilent); all samples had a RIN score >9 with clear 18S and 28S peaks ...
-
bioRxiv - Neuroscience 2020Quote: RNA quality was assessed with an Agilent 2100 Bioanalyzer and the Agilent RNA 6000 Nano kit (Agilent). 3’RNA-sequencing was performed using 100 ng of total RNA and the QuantSeq 3’ mRNA-Seq (#015.24 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 100ng was used for cDNA synthesis by AccuScript High Fidelity 1st Strand cDNA synthesis kit (Agilent) using the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... samples were tested using Envision dual link dakocytomation kit following the manufacturer’s protocol (Dako-Behring, Glostrup, Denmark). An irrelevant IgG was used as the primary antibody in controls ...
-
bioRxiv - Cell Biology 2021Quote: ... Fragments and mutant forms of BICD2 were produced using QuickChange Lighting Site-Directed Mutagenesis kit (Agilent Technologies) according to the manufacturer’s instructions using the following primers and the appropriate reverse complements:
-
bioRxiv - Biochemistry 2020Quote: ... All mutants of IFITM3 were generated by using QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies, #200523). Lipofectamine 3000 from Thermo Scientific was used for transfection of HEK293T cells.
-
bioRxiv - Cell Biology 2021Quote: ... The QuikChange II XL direct-mutagenesis kit was obtained from Stratagene (cat#200522, La Jolla, CA, USA) and the Vybrant Apoptosis Pacific Blue-annexin V kit and 7AAD from Invitrogen (cat#A35122).
-
bioRxiv - Microbiology 2020Quote: Total RNA quality was checked using a 2100 Bioanalyzer with the RNA 6000 Nano kit (Agilent Technologies) and rRNA was detected ...