Labshake search
Citations for Agilent :
2651 - 2700 of 5601 citations for Rat CD178 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... Quality and quantity of total RNA was determined with DNF-471 RNA Kit −15 nt (Agilent) in the Fragment Analyzer 5300 (Agilent) ...
-
bioRxiv - Biochemistry 2023Quote: ... The BDF1 point mutant plasmids were obtained using the QuikChange II Site-directed mutagenesis kit (Agilent) with the BDF1 plasmid pJG267 ...
-
bioRxiv - Cancer Biology 2022Quote: ... We used a Femto Pulse system with an Ultra Sensitivity RNA kit (Agilent, #FP-1201-0275) to analyze quality control metrics.
-
bioRxiv - Cancer Biology 2022Quote: ... and S104T mutations were introduced by use of the QuikChange Multi Site-Directed Mutagenesis Kit (Stratagene) into the pHEBO-IRF4-HAtag expression construct according to the manufactureŕs recommendations and by use of primers indicated in Extended Data Table 6 ...
-
bioRxiv - Cell Biology 2023Quote: ... pShuttle constructs were subsequently transfected into HEK293A cells using the AdEasy adenoviral production kit (Agilent Technologies). The recombinant adenovirus was plaque purified ...
-
bioRxiv - Cancer Biology 2023Quote: Mitochondrial respiration was evaluated using the Seahorse XF Cell Mito Stress Test Kit (Agilent 103015-100) with the Seahorse XFe96 Analyzer (Agilent) ...
-
bioRxiv - Biophysics 2023Quote: ... Mutations in WT hERG1a cDNA were made using the QuikChange site-directed mutagenesis kit (Agilent Technologies) and verified by DNA sequence analysis ...
-
bioRxiv - Genomics 2022Quote: The average library length was assessed using the BioAnalyzer DNA High Sensitivity kit (Agilent, 5067-4626) on an Agilent 2100 BioAnalyzer ...
-
bioRxiv - Genomics 2023Quote: ... and its integrity was determined by the Bioanalyzer 2100 kit (Agilent Technologies, Santa Clara, CA, USA). RNA libraries were prepared with the Illumina TruSeq TM RNA Sample Preparation Kit ...
-
bioRxiv - Cell Biology 2023Quote: ... The MLS-TFEB mutant was generated using the Quikchange XL site-directed mutagenesis kit (200521, Agilent). The ΔMTS mutant was generated by cloning a truncated sequence of TFEB in the pcDNA 3.1 FLAG backbone (121416 ...
-
bioRxiv - Genomics 2023Quote: Eight library preparations were carried out using the SureSelect Methyl-Seq Target Enrichment kit (Agilent, G9651) following the manufacturer’s protocol (User guide ...
-
bioRxiv - Genomics 2023Quote: ... and size distribution and degradation assessed using the Femto pulse Genomic DNA 165 kb Kit (Agilent). Purification steps were performed using AMPure PB beads (Pacific Biosciences) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sample quality assessment/size was validated by Bioanalyzer DNA-High Sensitivity Kit (Agilent Technologies, #5067-4626).
-
bioRxiv - Cancer Biology 2023Quote: FISH assay was performed on tissue microarrays using the Histology FISH accessory kit (K579911-2, Dako, Agilent Technologies ...
-
bioRxiv - Immunology 2023Quote: ... Cy3-labeled cRNA was synthesized and purified using the Low Input Quick Amp Labeling Kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... RNA quality was determined with a Bioanalyzer 2100 using an RNA 600 Nano kit (Agilent, USA). High quality of RNA was used to prepare RNA-Seq libraries with NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina® (New England BioLabs ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA quality was controlled using Agilent rna 6000 nano kit (5067-1511, Agilent, Santa Clara, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... Library quality was confirmed by using the Bioanalyzer High Sensitivity DNA Kit (Agilent Technologies, 5067-4626). Four libraries were pooled for pair-end sequencing with 100 cycles on a S1 flow cell lane in an Illumina NovaSeq 6000 System (UCSF Center for Advanced Technology) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... RNA quality was assessed using Agilent RNA 6000 Nano Kit on Agilent 2100 Bioanalyzer (Agilent, USA), and samples with RNA integrity number ≥ 8.0 were used for sequencing ...
-
bioRxiv - Plant Biology 2023Quote: ... and quality checked using the High Sensitivity DNA or RNA Kits for Fragment Analyzer (Agilent Technologies). Only RNA samples with a RQN above 7 were kept for further use ...
-
bioRxiv - Plant Biology 2023Quote: The AtSHMT1 (AT4G37930) amino acid substitutions were generated using a site-directed mutagenesis kit protocol (Stratagene). The primer-SD was used for Ser190 Leu ...
-
bioRxiv - Bioengineering 2023Quote: ... The resulting RNA-seq libraries’ quality and concentration were assessed using the D1000 DNA Kit (Agilent) on the TapeStation and a Qubit Fluorometer with the Qubit dsDNA HS Assay Kit (Life Technologies) ...
-
bioRxiv - Systems Biology 2024Quote: ... The DNA quality was assessed with an Agilent Bioanalyzer 2100 with a DNA 12000 Kit (Agilent Technologies ...
-
bioRxiv - Developmental Biology 2024Quote: ... The integrity of the RNA was determined using the TapeStation High Sensitivity RNA kit (Agilent Technologies). 10 ng of total RNA has been used to prepare ribo-depleted RNA-seq libraries with these kits ...
-
bioRxiv - Cancer Biology 2024Quote: ... Samples with RIN values ≥9.5 (assessed using using Agilent RNA 6000 Nano Kit (Agilent #5067-1511)) were carried forward for library prep using QuantSeq Forward kit (LEXOGEN #015.96 ...
-
bioRxiv - Cell Biology 2024Quote: ... size distribution was examined on the Fragment Analyzer with High Sensitivity NGS Fragment Analysis kit (Agilent), to ensure that the samples were the proper size ...
-
bioRxiv - Cancer Biology 2024Quote: ... Samples with RIN values ≥9.5 (assessed using using Agilent RNA 6000 Nano Kit (Agilent #5067-1511)) were carried forward for library prep using QuantSeq Forward kit (LEXOGEN #015.96 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and HCK ORFs were performed using QuickChange Lightening Site-Directed Mutagenesis kit (Agilent Technologies, Les Ulis) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... and library size and quality was determined via Bioanalyzer (Agilent High Sensitivity DNA Kit, 5067-4626). Libraries were first sequenced on an Illumina MiSeq using the 300-cycle kit (v2 ...
-
Cas13d-mediated isoform-specific RNA knockdown with a unified computational and experimental toolboxbioRxiv - Genomics 2023Quote: ... the RNA integrity number (RIN) was calculated using the RNA 6000 Nano Kit (Agilent #5067-1511). RIN scores ranged between 8.7-9.7 ...
-
bioRxiv - Cell Biology 2023Quote: ... The P878A mutation was generated from the WT plasmid using the Quikchange Lightning mutagenesis kit (Agilent) and primers (CCTAGGCCTCCACCAGCAGAGGAAAAGGATG ...
-
bioRxiv - Microbiology 2023Quote: ... and an Advanced Analytical Fragment Analyzer System using a Fragment Analyzer RNA Kit (Agilent, Basel, Switzerland), respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA quantity and quality were assessed using an Agilent RNA 6000 Pico Kit (#5067-1513; Agilent) with a 2100 Bioanalyzer (#G2939BA ...
-
bioRxiv - Neuroscience 2023Quote: ... and RNA quality was assessed using the RNA 6000 Pico Assay kit (#5067-1513, Agilent Technologies). Two male medial prefrontal cortex samples (50 μg/kg Mixed BP and 150 μg/kg Mixed BP ...
-
bioRxiv - Microbiology 2023Quote: ... libraries were visualized on an Agilent 2100 Bioanalyzer using Agilent High Sensitivity DNA kit (Agilent Technologies) and quantified using Qubit dsDNA HS DNA Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Biophysics 2024Quote: ... Mutants of BOSS and dROS1 were generated by site-directed mutagenesis using QuickChange Kit (Agilent Technologies). Proteins were purified from the medium (Ex-Cell405 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and library size distribution was measured with Bioanalyzer 2100 and High Sensitivity DNA Kit (Agilent Technologies). Final DNA libraries sequencing was performed in Illumina NovaSeq 6000 platform using the NovaSeq 6000 S1 Reagent Kit 300 cycles (2 x 150 paired-end reads ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA quality was further assessed using a total RNA kit on a 2100 Bioanalyzer (Agilent Technologies) and using the generated RIN number to determine quality ...
-
bioRxiv - Cancer Biology 2023Quote: ... and by using High Sensitivity NGS Fragment Analysis Kit (DNF-474) on a Fragment AnalyzerTM (Agilent). Libraries were then purified using Agencourt® AMPure® XP (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2023Quote: ... Full-length WDR5-K259A and WDR5-K259E mutants were generated by Site-Directed Mutagenesis Kit (Agilent). All proteins were expressed in the E ...
-
bioRxiv - Bioengineering 2023Quote: ... RNA integrity was assessed using the RNA 6000 Pico Kit for Bioanalyzer (Agilent Technologies #5067-1513), and mRNA was isolated from ∼1 μg of total RNA using NEB Next Poly (A ...
-
bioRxiv - Plant Biology 2024Quote: ... RNA quality was tested using the Bioanalyser Agilent RNA 6000 Pico Kit (Agilent Technologies, Waldbronn, Germany). Sequencing libraries were prepared with the TruSeq RNA Sample Prep Kit v2 and sequenced on the Illumina HiSeq 2000 ...
-
bioRxiv - Genomics 2024Quote: ... and fragment lengths were determined using the Genomic DNA 165 kb Kit (Agilent #FP-1002-0275) on the Femto Pulse System.
-
bioRxiv - Molecular Biology 2023Quote: ... and RNA integrity number (RIN) was assessed using RNA 6000 Nano Kit (Agilent, Cat# 5067-1511) on Agilent Bioanalyzer 2100 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 250ng RNA of each sample was retro-transcribed using Affinity Script cDNA synthesis kit (Agilent Technologies). 5ng of cDNA was used for the qRT-PCR reaction using Brilliant III Ultrafast SYBR Green QPCR master mix (Agilent Technologies ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and DNA quality was verified using a Bioanalyzer 2100 with high-sensitivity DNA kits (Agilent, Japan). Short-inserts of 150-bp paired-end libraries were prepared for each individual using a Nextera XT DNA Library Preparation Kit (Illumina ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... rosetta samples was assessed by Agilent Bioanalyzer 2100 (Fig. S1C) with the Agilent RNA 6000 Nano Kit (Agilent, Cat. No. 5067-1511). Then total RNA (500 ng per sample ...
-
bioRxiv - Developmental Biology 2024Quote: The quality of purified chromatin was assessed using the Bioanalyzer High Sensitivity DNA Analysis kit (Agilent). Libraries were sequenced using the NextSeq 500/550 Mid Output Kit v2.5 (150 Cycles ...
-
bioRxiv - Cell Biology 2024Quote: ... and the High Sensitivity NGS Fragment 1-6000bp kit on a 48-channel Fragment Analyzer (Agilent), respectively ...
-
bioRxiv - Plant Biology 2024Quote: ... The construct cpSRP54(Q185R) was generated using the QuikChange Lightning site-directed mutagenesis kit (Agilent Technologies) with pETDuet1™-cpSRP54 (Bals et al. ...