Labshake search
Citations for Agilent :
1951 - 2000 of 7234 citations for Human Low affinity immunoglobulin gamma Fc region receptor II c FCGR2C ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... Antigen-specific IgG was detected using rabbit anti-human IgG HRP (Dako, Glostrup, Denmark). ELISA plates were developed using TMB solution (Life Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... Library preparation was performed by using SureSelectXT Human All Exon V5 (Agilent, 5190–6209) according to the instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... DNA library hybridization was performed by using Agilent SureSelect Human All Exon V6 (Agilent). Paired-end sequencing (150 bp ...
-
bioRxiv - Microbiology 2024Quote: ... for 24 h or by 15 µg/ml α-human IgG (Agilent #A042301-2) for 48 h ...
-
bioRxiv - Cell Biology 2020Quote: ... quantified by performing PCR reaction using Brilliant II SYBR® Green QPCR Master Mix (Agilent Technologies, USA). The primer sequences for PCR analysis were as follows ...
-
bioRxiv - Cell Biology 2019Quote: The CH mutant was made from the CB construct by site-directed mutagenesis (Quikchange II XL, Agilent) (fwd ...
-
bioRxiv - Biochemistry 2019Quote: ... using a linear gradient from 5 to 55% acetonitrile over 6.5 min with 0.1% formic acid as the aqueous mobile phase after an initial hold at 95% 0.1% formic acid for 0.5 min (0.6 mL/min) using a 1290 Infinity II UHPLC (G7120AR, Agilent). Peptides were identified using LC-HRMS as described previously.23
-
bioRxiv - Plant Biology 2020Quote: ... and the NRG1.1 variants were generated following the QuikChange II Site-Directed mutagenesis (SDM) protocol (#200555, Agilent). Level 0 golden gate compatible construct for the genomic sequence of Col-0 EDS1 (AT3G48090.1 ...
-
bioRxiv - Cell Biology 2021Quote: ... The non-phosphorylatable sts5 sequences were generated by either site directed mutagenesis using QuikChange II mutagenesis (Stratagene) or mutant sequences were synthesized as a gBlocks Gene Fragment (Integrated DNA Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... and were used to PCR amplify around the pMMB67EH plasmid using PfuUltra II high-fidelity polymerase (Agilent). PCR products were purified (QIAGEN ...
-
bioRxiv - Biophysics 2022Quote: ... Mutagenesis and all DNA modifications were carried out using Pfu Ultra II Hotstart 2X Master Mix (Agilent). Mutagenesis primers for hIP3R1 F2586K forward (TCTTCATGGTCATCATCATTGTTCTTAACCTGATTAAGGGGGTTATCATTGACACT) ...
-
bioRxiv - Plant Biology 2021Quote: ... HPLC-UV and HPLC-fluorescence analysis were performed using a 1220 Infinity II LC system (Agilent Technologies) coupled to a Prostar 363 fluorescence detector (Varian) ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 Spike mutations were introduced using the QuikChange II XL site-directed mutagenesis protocol (Stratagene). The presence of the desired mutations was determined by automated DNA sequencing ...
-
bioRxiv - Biochemistry 2019Quote: The culture supernatants containing pre-NisA variants were analyzed by RP-HPLC (Agilent Technologies 1260 Infinity II). A LiChrospher WP 300 RP-18 end-capped column and an acetonitrile/water solvent system were used as described previously (Abts ...
-
bioRxiv - Biochemistry 2019Quote: ... For concentration determination the pre-NisA variants were analyzed by RP-HPLC (Agilent Technologies 1260 Infinity II) with a LiChrospher WP 300 RP-18 end-capped column and an acetonitrile/water solvent system as described previously (Abts ...
-
Chemoproteomics of microbiota metabolites reveals small-molecule agonists for orphan receptor GPRC5AbioRxiv - Biochemistry 2021Quote: Chemicals and membrane-filtered bacterial cultures were analyzed by 1290 Infinity II LC/MSD system (Agilent technologies) using Poroshell 120 EC-C18 column (2.1 x 50 mm ...
-
bioRxiv - Microbiology 2020Quote: ... Mutations in the constructs were generated by standard mutagenic PCR using PfuUltra polymerase (QuikChange II; Agilent Technologies).
-
bioRxiv - Immunology 2022Quote: ... Solid phase extraction was performed on methanol and sodium acetate conditioned Bond Elut Certify II cartridges (Agilent). After loading the samples ...
-
bioRxiv - Microbiology 2022Quote: ... RH or IN-deleted constructs were created by invert PCR using Pfu II Taq polymerase (Agilent Technology) with deletion primers (Table S1) ...
-
bioRxiv - Pathology 2022Quote: ... The 15 μl of reactional mix were composed of 1x Brillant II qPCR master mix (Agilent Technologies), 0.03 μM ref dye provided with the master mix ...
-
bioRxiv - Neuroscience 2022Quote: ... The pT7-7 plasmid was also modified using site directed mutagenesis (#200523, QuikChange II, Agilent, Waldbronn, Germany) to incorporate a cysteine residue at position 141 to permit dye-labelling of the aSyn protein ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... qPCR was performed on a Stratagene 3000 qPCR system using Brilliant II SYBR Master Mix (Agilent – 600828). Primer sequences are in Supplementary Data 1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... at a concentration of 1.5 ng/µl using the eukaryote total RNA pico series II assay (Agilent) to assess RNA integrity ...
-
bioRxiv - Neuroscience 2023Quote: ... The UHPLC system (1290 Infinity II) and triple quadrupole (QqQ) mass analyser (model 6495) was from Agilent Technologies (CA ...
-
bioRxiv - Cell Biology 2023Quote: ... I5S mutant (mt) RIIα-mTb-V5 plasmid was generated by site directed mutagenesis (QuikChange II XL, Agilent) based on the wild type (WT ...
-
bioRxiv - Biochemistry 2023Quote: The EQ2 mutations were introduced sequentially into each protein using QuikChange II Site-Directed Mutagenesis (Agilent Technologies) with all growth media supplemented with 0.4% (w/v ...
-
bioRxiv - Pathology 2023Quote: ... RCJ anthocyanin concentration was analyzed using a 375 1260 Infinity II HPLC (Agilent Technologies, Santa Clara, CA) with a reserved-phase column (Li Chrospher 100-5 RP18 250 × 4.0 mm ...
-
bioRxiv - Plant Biology 2023Quote: ... MBP-PLS(C17S) and MBP-PLS(C6S/C17S) were created by site-directed mutagenesis (QuikChange II, Agilent). E ...
-
bioRxiv - Genetics 2023Quote: ... Real-time PCR was done in duplicate with Brilliant II SYBR Green QPCR Master Mix (Agilent Technologies) and primers from IDTDna ...
-
bioRxiv - Developmental Biology 2023Quote: ... and the fragments were incorporated into a pBluescript II SK (−) vector plasmid (Agilent Technologies Japan, Hachioji, Japan). Start codon mutant constructs were generated by mutation PCR using the PrimeSTAR Mutagenesis Basal Kit (Takara Bio ...
-
bioRxiv - Physiology 2023Quote: ... Standard PCR reactions for cloning or site-mutagenesis were done using Herculase II Fusion polymerase (Agilent, Germany). All primers were ordered from Eurofins Genomics ...
-
bioRxiv - Neuroscience 2023Quote: ... qPCR was performed using the Brilliant II SYBR Green QPCR master mix (Agilent Technologies, Santa Clara, CA). The primers used are listed in Supplemental Table S1 ...
-
bioRxiv - Neuroscience 2023Quote: ... and the PCR fragment was subcloned into the EcoRV site of pBluescript II KS (+) vector (212207, Agilent) to generate pLRRK2#5 ...
-
bioRxiv - Bioengineering 2023Quote: HPLC was carried out using an Agilent 1260 Infinity II HPLC System (Agilent Technologies, San Jose, CA) equipped with a multiple wavelength UV detector (G7165A ...
-
bioRxiv - Cancer Biology 2023Quote: Targeted LC-MS analysis was performed using an Agilent 1290 Infinity II series UHPLC system from Agilent Technologies (Waldbronn ...
-
bioRxiv - Genetics 2024Quote: UTR-library DNA templates were assembled by overlap extension PCR with Herculase II Fusion Enzyme (Agilent Technologies). Initially ...
-
bioRxiv - Genetics 2024Quote: UTR-library DNA templates were assembled by overlap extension PCR with Herculase II Fusion Enzyme (Agilent Technologies). Initially ...
-
bioRxiv - Microbiology 2024Quote: ... Chromatographic separation of 5 µL sample was achieved on a 1290 Infinity II HPLC (Agilent Technologies, Germany) equipped with a Poroshell EC-C18 column (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2021Quote: ... at 4°C overnight diluted 1:200 in antibody diluent (#S3022, Dako). Negative controls were incubated with antibody diluent only ...
-
bioRxiv - Cancer Biology 2021Quote: ... at 37°C for 30 min followed by HRP- labeled streptavidin (Dako) at room temperature for 30 min ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... The GC was coupled with a 5975 C mass-spectrometer (Agilent Technologies). Mass spectra were recorded with electron impact ionization at 70 eV ...
-
bioRxiv - Neuroscience 2021Quote: ... Following antigen retrieval for 15 min at 80°C (pH 6.0; DAKO), tissues were incubated in block solution containing 0.3% Triton and 10% goat serum for 1 hr at room temperature (RT ...
-
bioRxiv - Neuroscience 2021Quote: ... for 20 min at 97°C using a PT Link (Dako – Agilent). Endogenous peroxidase was quenched with Peroxidase-Blocking Solution (S2023 ...
-
bioRxiv - Zoology 2019Quote: ... the sensors cartridges were hydrated at 37°C in calibration solution (Agilent). On the day of the assay ...
-
bioRxiv - Plant Biology 2020Quote: ... overnight followed by zip-tip cleanup using C-18 Omix tips (Agilent). Digests containing the unbiotinylated peptides were dried in a Speedvac as elution-1 (E1 ...
-
bioRxiv - Plant Biology 2020Quote: ... overnight followed by zip-tip cleanup using C-18 Omix tips (Agilent). Digests containing the unbiotinylated peptides were dried in a speedvac and stored at −20 °C until LC-MS/MS analyses.
-
bioRxiv - Molecular Biology 2021Quote: ... Sections were incubated at 4°C with anti-VWF (1:200, Dako) and anti-α-smooth muscle actin (1:100 ...
-
bioRxiv - Neuroscience 2021Quote: ... for 20 min at 97°C using a PT Link (Dako – Agilent). Endogenous peroxidase was quenched with Peroxidase-Blocking Solution (S2023 ...
-
bioRxiv - Cancer Biology 2020Quote: ... followed by 30 min incubation at 95°C in retrieval solution (Dako). The Dako Envision+System-HRP was used following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... and analyzed using a transmission quadrupole mass spectrometer (Agilent 5975 C series) with an electron ionization interface ...