Labshake search
Citations for Agilent :
1901 - 1950 of 7696 citations for Human Low affinity immunoglobulin gamma Fc region receptor II c FCGR2C ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... Glyko® Sialidase C™ was from Prozyme (Hayward, CA). All solutions were made with ultrapure Milli-Q water (Millipore ...
-
bioRxiv - Neuroscience 2021Quote: ... ICP-MS MassHunter 4.4 software Version C.01.04 from Agilent was used ...
-
bioRxiv - Genetics 2021Quote: ... while the longer “plasmid” PCR amplicons were generated using Herculase II Fusion DNA Polymerase (Agilent). Primer sequences used for chimeragenesis are listed in Table S8.
-
bioRxiv - Biochemistry 2021Quote: ... pre-equilibrated with reconstitution buffer on an Agilent 1260 Infinity II LC system (Agilent Technologies) at 4°C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... with the following composition: 0.5 μL Herculase II fusion DNA polymerase (Agilent, Santa Clara CA) per 50 μL reaction ...
-
bioRxiv - Cell Biology 2020Quote: The doxycycline-inducible Tiam1-AA (non-βTRCP-binding) mutant was generated by Quikchange II (Agilent) site-directed mutagenesis of WT-Tiam1 mouse cDNA at S329 and S334 ...
-
bioRxiv - Developmental Biology 2021Quote: ... genomic sequences were amplified from wildtype DNA using Herculase II fusion DNA polymerase (Agilent Technologies). Sequence coordinates in GRCz10 and primers used for amplification are listed in Table S2 ...
-
bioRxiv - Bioengineering 2020Quote: ... The prepared samples were analyzed with high-performance liquid chromatography (HPLC; 1260 Infinity II; Agilent) equipped with DAD detectors (G7115A ...
-
bioRxiv - Neuroscience 2021Quote: ... The full construct was inserted into the multiple cloning site of pBluescript II SK (+) (Stratagene).
-
bioRxiv - Plant Biology 2021Quote: ... The qRT-PCR was performed using the Brilliant II SYBR Green QPCR Master mix (Agilent) in real time PCR (Agilent Technologies ...
-
bioRxiv - Microbiology 2020Quote: ... The D614G mutation was introduced using the QuikChange II XL site-directed mutagenesis protocol (Stratagene). The presence of the desired mutations was determined by automated DNA sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... 120 μg of genomic DNA was amplified using DNA Herculase II Fusion DNA polymerase (Agilent) in the presence of 2% DMSO ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed using the PfuUltra II Fusion High-fidelity DNA polymerase (Agilent, California, USA) using genomic template DNA extracted using QuickExtract DNA extraction solution (Epicentre/ Lucigen ...
-
bioRxiv - Microbiology 2020Quote: ... Viral cDNA was amplified by PCR using the Herculase II polymerase (Agilent, Santa Clara, CA) and amplified viral cDNA was gel purified using a Spin Gel Purification kit (Qiagen) ...
-
bioRxiv - Cell Biology 2021Quote: ... and was analyzed by qPCR using the Brilliant II SYBR Green QPCR Master Mix (Agilent Technologies ...
-
bioRxiv - Biochemistry 2022Quote: ... Point mutants were introduced using whole plasmid amplification with Pfu Ultra II (Agilent, 600670-61) and complementary primers ...
-
bioRxiv - Biochemistry 2021Quote: ... The gradient was delivered by the 1290 Infinity II LC System (Agilent Technologies, Waldbronn, Germany) at a flow rate 40 μL·min−1 ...
-
Cryo-EM structure of a eukaryotic zinc transporter at a low pH suggests its Zn2+-releasing mechanismbioRxiv - Biochemistry 2022Quote: ... Mutations were introduced by site-directed mutagenesis using QuikChange II system (Agilent, Santa Clara, CA) according to manufacturer’s recommendation ...
-
bioRxiv - Cell Biology 2019Quote: ... we used Roche’s LightCycler and Brilliant II SYBR® Green QRT-PCR Master Mix (Agilent).
-
bioRxiv - Microbiology 2020Quote: ... the samples were analyzed sequentially with an UHPLC (Agilent 1290 II Infinity, Agilent Technologies, USA) coupled to an IM-QTOF mass spectrometer (Agilent 6560 IM-QTOF ...
-
bioRxiv - Cell Biology 2019Quote: ... MCM7 forward: CCCCTCTTTCTCCCATGCTG reverse: AGGCCCAGGCTAGAAGATGA) and Brilliant II SYBR Green qPCR Master Mix (Agilent, 600828).
-
bioRxiv - Cell Biology 2020Quote: ... were generated using site-directed mutagenesis with PfuUltra II Fusion polymerase (Agilent, Santa Clara, CA) (Supplementary File 3 ...
-
bioRxiv - Molecular Biology 2021Quote: ... with the exception of PfuUltra II Fusion HS DNA Polymerase that was procured from Stratagene, Sweden ...
-
bioRxiv - Molecular Biology 2021Quote: ... Each 20 μL reaction was prepared using the Brilliant II SYBR Green QPCR system (Agilent) following the manufacturer’s guidelines with the primers listed in Table S2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... the UHPLC system used in this work was a 1290 Infinity II system from Agilent Technologies (Santa Clara ...
-
bioRxiv - Molecular Biology 2022Quote: The ABE7.10 mutant library was generated with error prone PCR using GeneMorph II (Agilent #200550) in the high mutation rate condition as described in manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... Mutant constructs were generated using site directed mutagenesis using PfuUltra II high fidelity polymerase (Agilent) and following manufacturer’s protocol ...
-
bioRxiv - Genetics 2022Quote: ... with appropriate primers (Table S9) and the Pfu Ultra II Fusion HS DNA (#600674, Agilent) polymerase ...
-
bioRxiv - Microbiology 2022Quote: The analysis of enzymatic reactions was performed on Infinity II 1260 Liquid Chromatography system (Agilent). Separation of the enzymatic reaction products occurred on YMC-Triart C18 column in 30 mM ammonium acetate buffer system (pH 4.3 ...
-
bioRxiv - Physiology 2022Quote: ... hIP3R3 and hIP3R1 were generated using Pfu Ultra II Hotstart 2X Master Mix (Agilent Technologies) and appropriate primers obtained from Integrated DNA Technologies (Table ...
-
bioRxiv - Microbiology 2022Quote: ... Quantitative qRT-PCR was performed with the Brilliant II SYBR Green QPCR Master Mix (Agilent). Primers were designed to amplify ∼150 bp product within the target genes ...
-
bioRxiv - Plant Biology 2022Quote: ... samples were analyzed using HPLC system 1260 Infinity II (Agilent Technologies, Santa Clara, CA, USA) equipped with Kinetex C18 (50 mm x 2.1 mm ...
-
bioRxiv - Developmental Biology 2024Quote: ... sgRNAs were amplified and equipped with adapters using Herculase II Fusion DNA Polymerase (Agilent, #600677) for 25 cycles ...
-
bioRxiv - Microbiology 2024Quote: ... The plasmid pEGFP-Dynamin 2.WT was constructed using a Quik Change II XL (Agilent) site-directed mutagenesis kit to change the GCC (alanine ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR reactions were performed using a Pfu-Ultra II Fusion High Fidelity DNA Polymerase (Agilent), whereas Gibson Assembly was performed using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) ...
-
bioRxiv - Microbiology 2024Quote: Five microliters were injected into a 1290 Infinity II LC UHPLC system (Agilent, CA, USA) connected to either a 6550 Series or 6540 Series Q-TOF mass spectrometer (Agilent ...
-
bioRxiv - Cell Biology 2024Quote: ... The PCR was performed using cDNA (50ng) and a Brilliant II sybr green mastermix (Agilent). Both the PCR array and qPCR were run on an Agilent AriaMx PCR machine ...
-
bioRxiv - Cancer Biology 2024Quote: ... sgRNA was amplified from 50 mg gDNA using Herculase II Fusion DNA Polymerase (Agilent Technologies), column purified using Select-a-Size DNA Clean & Concentrator kit (Zymo Research) ...
-
bioRxiv - Cancer Biology 2023Quote: Each library preparation PCR reaction contained the following components: 1μl Herculase II Fusion Enzyme (Agilent), 2.5μl Deoxynucleotide (dNTP ...
-
bioRxiv - Genomics 2023Quote: ... the PCR was performed in duplicate per ligation reaction using Herculase II reagents (Agilent Technologies). The parallel library preparations and PCR reactions were subsequently pooled for each reaction ...
-
bioRxiv - Immunology 2023Quote: ... Approximately 3 µg of AC3 was injected into 1290 Infinity II UHPLC system (Agilent Technologies) containing a Premier CSH-C18 column (Waters Corporation) ...
-
bioRxiv - Microbiology 2023Quote: ... Mutants were generated by site directed mutagenesis using QuikChange II (Agilent, Santa Clara, CA, USA) and validated via Sanger sequencing (GeneWiz ...
-
bioRxiv - Microbiology 2023Quote: ... and qPCR was performed using the Brilliant II SYBR® Green QPCR master mix (Agilent). PCR primer sequences included XIAP (F ...
-
bioRxiv - Biochemistry 2022Quote: The selected nucleotide sequence was amplified by PCR using Herculase II Fusion Enzyme (Agilent, USA) with specific oligonucleotide primer pairs incorporating p15TV-L adapters ...
-
bioRxiv - Bioengineering 2023Quote: ... Compounds were identified with a refractive index detector (1260 Infinity II Refractive Index Detector, Agilent) at 50C ...
-
bioRxiv - Bioengineering 2023Quote: ... at 40C and detected with an HPLC fluorescence detector (1260 Infinity II Fluorescence Detector, Agilent) at an excitation/emission spectra of 384/478 nm ...
-
bioRxiv - Biochemistry 2023Quote: ... PCR reactions were performed using a Pfu-Ultra II Fusion High Fidelity DNA Polymerase (Agilent). All sequences were verified using Sanger sequencing (Microsynth) ...
-
bioRxiv - Plant Biology 2023Quote: ... PCR amplification was carried out using Herculase II Fusion DNA Polymerase enzyme (Agilent Genomics, USA) with specific primers (Supplemental Table S1).
-
bioRxiv - Neuroscience 2023Quote: qRT-PCR reactions were performed using Brilliant II SYBR Green qPCR Master Mix (Agilent #600828) according to manufacturer instructions using a Light Cycler HT7900 (Roche) ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA fragment encoding Kif23 (NM_024245, nucleotides 866-1367) was cloned into pBluescript II SK (–) (Stratagene). Digoxigenin-labeled RNA probe was synthesized using DIG RNA labeling kit (Roche) ...