Labshake search
Citations for Agilent :
151 - 200 of 2720 citations for Dengue Virus Serotype 3 NS1 Protein Insect Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... A 10-minute protein block step with Serum-Free Protein Block (X0909, Agilent DAKO) to prevent non-specific binding was followed by a 1-hour incubation in primary antibody (pERK ...
-
bioRxiv - Cancer Biology 2019Quote: ... Protein Blocking reagent (Dako, X0909) and Bloxall blocking solution (Vector ...
-
bioRxiv - Cancer Biology 2020Quote: ... dry protein A cartridges (Agilent) were primed in PBS at 300 μL/min before loading 1 mg of antibody at 1 mg/mL ...
-
bioRxiv - Cancer Biology 2023Quote: ... Protein Blocking reagent (Dako, X0909) and Bloxall blocking solution (Vector ...
-
bioRxiv - Cancer Biology 2023Quote: ... blocked in Protein block (DAKO) for 10min at RT ...
-
bioRxiv - Cell Biology 2023Quote: ... BSA and Protein block (Dako). Sections were stained with primary antibodies against GFP (ab290 ...
-
bioRxiv - Biochemistry 2019Quote: ... with a Supelco Discovery BIO wide Pore C18-3 column (4.6 x 150 mm, 3 µm particle size) using an Agilent 1260 High pressure Gradient System (Agilent, Waldbronn, Germany). The column was operated with a flow rate of 1 mL/min and performed ultrapure water with 0.1% (v/v ...
-
bioRxiv - Bioengineering 2021Quote: ... were extracted from freeze-dried sludge samples with a 3 h digestion time and 3% sulfuric acid and then analyzed by a gas chromatography-mass spectrometry (GC-MS) (Agilent, USA) with 7890A-5975C model (Lanham et al. ...
-
bioRxiv - Plant Biology 2022Quote: His6-MBP-PFA-DSP protein fusions or free His8-MBP were expressed in Escherichia coli BL21 CodonPlus (DE3)-RIL cells (Stratagene). Overnight bacterial cultures were inoculated 1:1000 into fresh 2YT medium (1.6 % tryptone ...
-
bioRxiv - Biochemistry 2022Quote: ... constructs containing DNA encoding 8X-His-tagged CHI-domain-containing proteins were transformed into BL21-CodonPlus (DE3)-RIPL Competent Cells (Agilent) for recombinant protein expression ...
-
bioRxiv - Biochemistry 2023Quote: His6-SUMO-tagged and His6-SUMO-SNAP-tagged Tm1 protein constructs and GST-Khc 1- 365 were expressed in BL21-CodonPlus(DE3)-RIL cells (Stratagene) by isopropyl β-D-1- thiogalactopyranoside (IPTG ...
-
bioRxiv - Cell Biology 2023Quote: ... Vectors encoding the recombinant proteins were constructed as described in the previous section and introduced into the BL21-CondonPlus (DE3)-RIL competent cells (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2024Quote: ... The supernatants were fractionated on a reversed-phase Supelco Discovery BIO wide Pore C18-3 (4.6 × 150 mm, 3 µm particle size) column operated by a HPLC Agilent 1200 (Agilent Technologies, Waldbronn, Germany) chromatography system ...
-
bioRxiv - Immunology 2022Quote: Naive CD3+ T cells were placed on PLL-coated Seahorse Bioanalyzer XFp culture plates (3 × 105 cells/well) with Seahorse XF RPMI Assay Media (RPMI Medium, pH 7.4, 103576-100; Agilent Technologies, Santa Clara, CA, USA), supplemented with 10 mM glucose (103577-100 ...
-
bioRxiv - Neuroscience 2023Quote: ... 50,000 cells per well were plated after 3 days of induction in a specialized Seahorse analyzer 96-well plate (Agilent, cat. no. 103774-100). Cells were washed in PBS once and incubated in a hypoxic chamber following the manufacturer’s procedure ...
-
bioRxiv - Neuroscience 2023Quote: ... 50,000 cells per well were plated after 3 days of induction in a specialized Seahorse analyzer 96-well plate (Agilent, cat. no. 103774-100). 10-12 day old i3Neurons were treated with 5 nM vincristine ...
-
bioRxiv - Cancer Biology 2022Quote: ... Anti-Ki-67 (Antigen Clone TEC-3) antibody (Dako), anti-Cleaved Caspase 3 (Asp175 ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3+ according to the HercepTest™ Interpretation Manual (DakoCytomation).
-
bioRxiv - Genomics 2020Quote: ... Ki67 (rat, DAKO M7249, clone TEC-3, 1:100), Carbonic Anhydrase 2 (rabbit ...
-
bioRxiv - Immunology 2023Quote: ... the peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... Agilent Bio SEC-3 Column (Agilent Technologies, CA, USA) or HiLoad 16/60 Superdex 200 pg SEC column (GE Healthcare ...
-
bioRxiv - Microbiology 2023Quote: ... using the Bio SEC-3 300A HPLC column (Agilent) and an isocratic elution with 100 mM ammonium acetate (pH 7.0 ...
-
bioRxiv - Neuroscience 2023Quote: Primary antibodies to the following proteins were used at the indicated concentrations: ubiquitin (1:1000, P4G7, BioLegend; 1:200 Cell Signaling; 1:200, Z0458, Dako), GABARAP (1:1,000 ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were washed thrice with 0.1% (v/v) tween-20 / PBS and incubated in Serum Free Protein Block (DAKO, cat.#X0909) for 1h at 21°C ...
-
bioRxiv - Cell Biology 2023Quote: ... and the N-terminal 6xHis-tagged and C-terminal EGFP-tagged proteins were expressed in Arctic Express (DE3) RP cells (Agilent Technologies). Bacterial cultures in LB medium were induced with 0.1-0.2 mM IPTG at exponential growth phase (OD600 = 0.5-0.6 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Protein Block Serum Free reagent (Dako). Primary antibody incubation was performed at 4°C overnight using the ideal dilution for each antibody (Supplementary Table 5) ...
-
bioRxiv - Cell Biology 2021Quote: ... and incubated in Protein Block (Dako) for 5 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... and protein (Dako cat. no. X0909) blocking reagents for 5 minutes each ...
-
bioRxiv - Microbiology 2023Quote: ... AdvanceBio SEC 300Å protein standard (Agilent) was included to correlate the elution volume with molecular weight.
-
bioRxiv - Microbiology 2023Quote: ... diluted with protein block buffer (Dako) for 2 hours ...
-
bioRxiv - Cancer Biology 2023Quote: ... protein blocker (Agilent Technology, X090930-2). Slides were incubated with a biotinylated anti-pimonidazole mouse IgG1 monoclonal antibody diluted 1:50 in Background Sniper (Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... Dako Protein Block (Agilent Cat#X0909), ‘Normal’ block (Agilent Cat#S202386-2) ...
-
bioRxiv - Genomics 2022Quote: ... we established an automated 3’UTR-seq (QuantSeq 3’mRNA-seq; Lexogen GmbH, Vienna) using the Agilent NGS Workstation (Agilent Technologies, Santa Clara) at The Centre for Applied Genomics (TCAG ...
-
bioRxiv - Cancer Biology 2022Quote: ... MCF7-ESR1Y537S cells were seeded at a density of 3×104 in corresponding treatment media without phenol red in each well of the XFp Cell Culture miniplates (Seahorse Bioscience Inc., Billerica, MA, USA). The next day ...
-
bioRxiv - Genomics 2020Quote: ... A D1000 Screen Tape assay (Agilent, Cat.5067-5582/3) was used with the 2200 Tape Station (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cytokeratin (AE1/3) and vimentin (V9) were purchased from Dako Agilent Technologies ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and endogenous peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 x 2.0 mm Polaris 3 C8-A column (Agilent, Middelburg ...
-
bioRxiv - Microbiology 2023Quote: ... or 3) a HiPlex H column (4.6 x 250mm, Agilent). For 1) ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Immunology 2020Quote: ... proteins were tetramerized with streptavidin-APC (Prozyme) or streptavidin-AlexaFluor488 (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... Proteins were tetramerized with streptavidin-APC (Prozyme), streptavidin–Alexa Fluor 488 (Invitrogen) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Additional protein block from Dako (X090930-2) was applied ...
-
bioRxiv - Neuroscience 2023Quote: ... blocked (30 min, protein block X0909, Dako), and stained overnight at 4°C using primary antibodies detecting F4/80 ...
-
bioRxiv - Immunology 2023Quote: ... using the Protein G AssayMAP Bravo (Agilent) system ...
-
bioRxiv - Immunology 2023Quote: ... using the Protein G AssayMAP Bravo (Agilent) system ...
-
bioRxiv - Microbiology 2021Quote: ... and the AEC substrate 3-amino-9-ethylcarbazole (Dako, Carpinteria, CA). Moreover ...