Labshake search
Citations for Agilent :
151 - 200 of 3452 citations for 8 chloro 10 3 dimethylamino propyl phenothiazin 1 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... Step 3 was endogenous peroxidase blocking (Dako REAL Peroxidase-blocking reagent ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3′ - Diaminobenzidine (DAB+) solution (DakoCytomation, Glostrup, Denmark), and counterstained by Harris hematoxylin.
-
bioRxiv - Bioengineering 2019Quote: ... The microtissues were then washed in PBS (3 × 1 hour) before mounting on glass slides using fluoro-safe mounting media (Dako, S3023). Mounted samples were allowed to cure for 1 day and then imaged using a confocal microscope (Zeiss LSM700 Confocal Microscope).
-
bioRxiv - Neuroscience 2021Quote: ... DNA was labeled with Hoechst (1:2000) for 3 min and the sections were mounted using fluorescence mounting media (Dako, S3023). All images were taken using a Zeiss Observer Z1 fluorescent microscope using a 10X objective ...
-
bioRxiv - Systems Biology 2023Quote: ... Tissues next underwent antigen retrieval was carried out by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating them at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Organoids were incubated in the following primary antibodies for 3 h at 24L: gastrin (1:1000, Cat #A0568, A0568, AB_2757270, Dako Agilent Technologies), Chromogranin A (1:100 ...
-
Chameleon microRNAs in breast cancer: their elusive role as regulatory factors in cancer progressionbioRxiv - Systems Biology 2020Quote: ... The samples were hybridized on Agilent 8×15K arrays (Agilent Technologies, Santa Clara, CA), catalogue number 4470B (v2 ...
-
bioRxiv - Genomics 2019Quote: ... and a well- established 8×60K fetal DNA chip (Agilent Technologies, Santa Clara, CA).
-
bioRxiv - Microbiology 2020Quote: A customized whole-genome DNA microarray of 630Δerm was used (8×15K format, Agilent) (50) ...
-
bioRxiv - Plant Biology 2019Quote: An 8×60K customized pea eArray (ID 045803, Agilent Technologies, Santa Clara, CA, USA) was used to scan the pea embryo transcriptome ...
-
bioRxiv - Developmental Biology 2021Quote: Transcriptomic profiling of the samples was performed with pikeperch-specific microarrays (8×60k, Agilent), which were designed and successfully validated previously (for details ...
-
bioRxiv - Developmental Biology 2021Quote: ... and hybridized with the custom microarrays (ID:085740, 8 x 60k arrays; Agilent Technologies) for 17h at 65°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were permeabilized using 0.2% Triton X-100 (Fisher) in 1:10 dilution Blocking Buffer (Dako) for 30 minutes at room temperature ...
-
bioRxiv - Neuroscience 2019Quote: ... The Western blot was stained with DAKO-Tau (1:10 000, Dako/Agilent, cat no A0024), while the second gel was stained with Colloidal Coomassie Staining solution (0.1% Coomassie Blue G250 ...
-
bioRxiv - Neuroscience 2019Quote: ... The Western blot was stained with DAKO-Tau (1:10 000, Dako/Agilent, cat no A0024), while the second gel was stained with Colloidal Coomassie Staining solution (0.1% Coomassie Blue G250 ...
-
bioRxiv - Biochemistry 2021Quote: ... CCH-1 and CCH-10 EGFR sequences using Quikchange Lightning site-directed mutagenesis kit (Agilent Technologies), according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... Coverslips were blocked for 1 hour with PBS supplemented with 10% normal goat serum (X0907, Agilent). Primary antibodies (Supplementary Table 3 ...
-
bioRxiv - Cell Biology 2022Quote: ... samples were exposed to antigen retrieval (10 minutes at 105°C in 1 x TRS (DAKO)) ...
-
bioRxiv - Genetics 2019Quote: ... A DNA fragment corresponding to the 700 bp upstream region of the PaPKS1 ORF was amplified with oligonucleotides 5’ tcgccgcggGCTAGGGGGTACTGATGGG 3’ and 5’ cacgcggccgcCTTGGAAGCCTGTTGACGG 3’ (capital letters correspond to P. anserina genomic DNA sequences) and cloned in SKpBluescript vector (Stratagene) containing the nourseothricin-resistance gene Nat in the EcoRV site (vector named P1 ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Physiology 2020Quote: ... Acetone was measured using an agilent DB-35MS column (30 m 3 0.25mm i.d. 3 0.25 mm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...
-
bioRxiv - Immunology 2019Quote: ... and 20μg/mL anti-Ki67 (TEC-3, Dako) antibodies diluted in TBS with 2% donkey serum for 3 hours at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fragment 3 was pBluescript KS (-) (Stratagene, California USA), which was digested using Xba ...
-
bioRxiv - Pathology 2021Quote: ... 3′-diaminobenzidine tetra-hydrochloride chromogen (DAB, K3468, Dako) was added to all sections and the reaction was stopped with distilled water ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2023Quote: ... then labeled using Cyanin-3 CTP (Agilent Technologies) and hybridized on chips containing 45000 probes (4×44K Whole Human Genome) ...
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm 2.7 μm HPLC column (Agilent) with a Poroshell 120 PFP ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were washed with Bond Wash buffer 3 x 30s and then incubated with either mouse anti-CD68 (M0814, 1:100, Dako, Carpenteria, CA), mouse anti-βIII-Tubulin (G7121 ...
-
bioRxiv - Immunology 2022Quote: ... Assays were conducted using an XFp (8 well) system and analyzed using WAVE software (Agilent).
-
bioRxiv - Microbiology 2020Quote: ... One-color whole mouse (084809_D_F_20150624 slides) 60-mer oligonucleotide 8×60k v2 microarrays (Agilent Technologies) were used to analyze gene expression ...
-
bioRxiv - Microbiology 2022Quote: ... 800 rpm for 8 hours in a BioTek LogPhase 600 plate reader (Agilent Technologies, Inc.). Cell growth was monitored by measuring OD600 every 20 min ...
-
bioRxiv - Plant Biology 2020Quote: ... 4 μg of total RNA with an RNA Integrity Number (RIN) ≥ 8 (Bioanalyzer 2100, Agilent Technologies ...
-
bioRxiv - Immunology 2021Quote: Agilent SurePrint G3 Mouse Gene Expression 8×60K Microarrays (Agilent Technologies, Santa Clara, CA, USA) were used for microarray experiments on purified CD4+CD25-CD62L-spleen lymphocytes ...
-
bioRxiv - Pathology 2023Quote: ... The slides were pre-treated by incubating 8 minutes with Peroxidase Blocking Reagent (S2001, DAKO). For ER ...
-
bioRxiv - Pathology 2023Quote: ... The slides were pre-treated by incubating 8 minutes with Peroxidase Blocking Reagent (S2001, DAKO). For CK5/6 ...
-
bioRxiv - Pathology 2023Quote: ... The slides were pre-treated by incubating 8 minutes with Peroxidase Blocking Reagent (S2001, DAKO). A monoclonal rabbit Ki67 antibody (M7240 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The sections were immunostained using EnVision and ARK kits (DAKO, K400311-2 and K395411-8) according to manufacturer protocols ...
-
bioRxiv - Microbiology 2023Quote: ... RNA integrity number (RIN) was >8 for all samples (Agilent 1200 bioanalyzer, Alpha Metrix Biotech). Labeling of total RNA (100 ng ...
-
bioRxiv - Immunology 2021Quote: ... pH 10) and buffer B (10 mM ammonium formate, 90% ACN, 10% H2O, pH 10) using an Agilent 1200 HPLC (Agilent Technologies, Santa Clara, USA). In total ...
-
bioRxiv - Biochemistry 2019Quote: ... with a Supelco Discovery BIO wide Pore C18-3 column (4.6 x 150 mm, 3 µm particle size) using an Agilent 1260 High pressure Gradient System (Agilent, Waldbronn, Germany). The column was operated with a flow rate of 1 mL/min and performed ultrapure water with 0.1% (v/v ...
-
bioRxiv - Bioengineering 2021Quote: ... were extracted from freeze-dried sludge samples with a 3 h digestion time and 3% sulfuric acid and then analyzed by a gas chromatography-mass spectrometry (GC-MS) (Agilent, USA) with 7890A-5975C model (Lanham et al. ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The hybridisation mix was prepared by mixing the specified amounts of RNA with 10× Gene Expression Blocking Agent (1× final conc.) and 2× Hi-RPM Hybridization Buffer (1× final conc.) (Agilent, Cat No. 5188-5242) in a final volume of 42 μl ...
-
bioRxiv - Plant Biology 2019Quote: ... An aliquot of the sample (1:10 diluted) was injected in the column of LC-MS (Agilent). The LC had 50 mm x 2.1mm ...
-
bioRxiv - Physiology 2020Quote: ... Slides were blocked with 20% FCS in PBS and incubated overnight with 1/10 anti-insulin (Dako) and 1/500 anti-Ki67 (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were immunoblotted with the following primary antibodies: polyclonal rabbit Anti-Human Tau (1:10 000, Dako) and monoclonal mouse Anti-Actin (1:25 000 ...